Molecular analysis of the bacterial diversity in a specialized consortium for diesel oil degradation

Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega), and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones), followed by Alphaproteobacteira (44.8 %) and Betaproteobacteria (5.4 %). The Pseudomonas genus was the most abundant in the metagenomic library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI), a strong correlation was found between the data generated by the software used and the data deposited in NCBI.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Polymorphism of the grasshopper Rhammatocerus schistocercoides populations revealed by RAPD

The objective of this work was to study the genetic variability of the grasshopper Rhammatocerus schistocercoides (Orthoptera: Acrididae) using RAPD analysis among individuals from three populations, one from Colombia and two from Brazil (Goiás and Mato Grosso States). Ninety scorable binary markers were obtained by fingerprinting with 11 oligonucleotide primers. Most of the polymorphism was attributed to 42 markers with variable frequency among the different populations. Although the existence of significant difference among populations (P<0.0001), most of the genetic variability was found within populations (87.7% of total variation). Pairwise distances between Colombian and Brazilian populations were 0.12 (P<0.0001) and 0.18 (P<0.0001) for Goiás and Mato Grosso, respectively. The pairwise distance between Goiás and Mato Grosso populations was 0.06 (P<0.0001). These data indicated that the phenotypic differences among populations are associated mainly with the geographical distances between the Brazilian and Colombian populations.

Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins

In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp.) skin, Desmodium ovalifolium, red grape (Vitis vinifera) skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (P<0.01) when the controls were compared to either buffer treatments due to tannin type, buffer used and the interaction of tannin type and buffer. The significant interaction indicates the influence of tannin type on the parameters evaluated.

Genetic characterization of the Moxotó goat breed using RAPD markers

The objective of this study was to verify the genetic diversity between and within seven populations of Moxotó goat (n = 264) from the States of Pernambuco, Paraíba and Rio Grande do Norte, using RAPD (Random Amplified Polymorphic DNA). Moxotó, as well as other naturalized breeds, suffers genetic losses due to the indiscriminate miscegenation with breeds raised in the Northeast Region of Brazil. The genetic characterization of these genetic resources is essential to conservation and breeding programs. DNA was extracted from lymphocytes using a non-organic protocol. The 16 primers used were selected from 120 decamer oligonucleotide primers and generated 56 polymorphic bands. The analysis of molecular variance (AMOVA) showed that the greater part of total genetic variability (71.55%) was due to differences between individuals within populations, while 21.21% was among populations. The analysis of variance among the pairs of populations demonstrated that the populations located in Floresta, PE x Angicos, RN presented a smaller value of intrapopulational differentiation (8.9%), indicating low genetic variability among them. Nei's genetic distances varied between 0.0546 and 0.1868 in the populations. The dendrogram generated showed that the Canindé breed, used as outgroup, clustered with the populations of Moxotó, indicating a possible common origin of the naturalized goat breeds.

Stability of Citrus tristeza virus protective isolates in field conditions

The objective of this work was to monitor the maintenance of Citrus tristeza virus (CTV) protective isolates stability in selected clones of 'Pêra' sweet orange (Citrus sinensis), preimmunized or naturally infected by the virus, after successive clonal propagations. The work was carried out in field conditions in the north of Paraná State, Brazil. Coat protein gene (CPG) analysis of 33 isolates collected from 16 clones of 'Pêra' sweet orange was performed using single strand conformational polymorphism (SSCP). Initially, the isolates were characterized by symptoms of stem pitting observed in clones. Then viral genome was extracted and used as template for the amplification of CPG by reverse transcription polimerase chain reaction (RTPCR). RTPCR products electrophoretic profiles were analyzed using the Jaccard coefficient and the UPGMA method. The majority of the clones had weak to moderate stem pitting symptoms and its CTV isolates showed alterations in the SSCP profiles. However, the stability of the protective complex has been maintained, except for isolates from two analised clones. Low genetic variability was observed within the isolates during the studied years.

Identification and characterization of a resistance gene analog (RGA) from the Caricaceae Dumort family

The majority of cloned resistance (R) genes characterized so far contain a nucleotide-binding site (NBS) and a leucine-rich repeat (LRR) domain, where highly conserved motifs are found. Resistance genes analogs (RGAs) are genetic markers obtained by a PCR-based strategy using degenerated oligonucleotide primers drawn from these highly conserved "motifs". This strategy has the advantage of the high degree of structural and amino acid sequence conservation that is observed in R genes. The objective of the present study was to search for RGAs in Carica papaya L. and Vasconcellea cauliflora Jacq. A. DC. Out of three combinations of primers tested, only one resulted in amplification. The amplified product was cloned in pCR2.1TOPO and than sequenced using M13 forward and reverse primers. Forty-eight clones were sequenced from each species. The 96 sequences generated for each species were cleaned of vector sequences and clustered using CAP3 assembler. From the GENEBANK, one RGA was identified in C. papaya showing a BlastX e-value of 2x10-61 to the gb|AAP45165.1| putative disease resistant protein RGA3 (Solanum bulbocastanum). To the extent of our knowledge this is the first report of a RGA in the Caricaceae Dumort family. Preliminary structural studies were performed to further characterize this putative NBS-LRR type protein. Efforts to search for other RGAs in papaya should continue, mostly to provide basis for the development of transgenic papaya with resistance to diseases.

Ocorrência de pectobactérias em tubérculos de batata-semente no estado do Rio Grande do Sul

Tubérculos de batata (Solanum tuberosum)-semente, pré-básica, básica, registrada e certificada, de oito cultivares, oriundos de 21 lavouras localizadas nos municípios de Vacaria, Canguçu, Piratini e Ibiraiaras, no Rio Grande do Sul, foram coletados nos meses de maio a agosto de 2002. Cada tubérculo foi lavado em água corrente, deixado secar à temperatura ambiente, perfurado com palitos em dez lenticelas, coberto com fina camada de óleo de soja, colocado individualmente em cima de folha de papel toalha umedecida dentro de saco plástico transparente e incubado a 23 ºC por quatro dias. A incidência de podridão mole a partir das lenticelas variou de 20_100% entre as cultivares. Pectobacterium sp. foi constatada em tubérculos das 21 lavouras. Duzentos e vinte e três isolados de Pectobacterium sp. foram obtidos em meio CPG, a partir das lenticelas com podridão mole, e identificados por testes bioquímicos, fisiológicos e PCR em nível de subespécie. Cento e dezenove isolados foram identificados como P. carotovorum subsp. brasiliensis e e 96 com o P. carotovorum subsp. carotovorum. Oito isolados não se enquadraram na classificação bioquímica. Pectobacterium carotovorum subspp. estavam presentes em tubérculos de batata-semente, independente da cultivar, classe ou município de origem. Pectobacterium carotovorum subsp. atrosepticum, a principal responsável por causar canela preta em batata em outros países, não foi detectada.

Development of a scar marker for Pierce's Disease strains of Xylella fastidiosa

The objective of this research was to develop a primer for a polymerase chain reaction specific for Xylella fastidiosa strains that cause Pierce's Disease (PD) in grapes (Vitis vinifera). The DNA amplification of 23 different strains of X. fastidiosa, using a set of primers REP1-R (5'-IIIICGICGIATCCIGGC-3') and REP 2 (5'-ICGICTTATCIGGCCTAC-3') using the following program: 94 ºC/2 min; 35 X (94 ºC/1 min, 45 ºC/1 min and 72 ºC/1 min and 30 s) 72 ºC/5 min, produced a fragment of 630 bp that differentiated the strains that cause disease in grapes from the other strains. However, REP banding patterns could not be considered reliable for detection because the REP1-R and REP 2 primers correspond to repetitive sequences, which are found throughout the bacterial genome. The amplified product of 630 bp was eluted from the agarose gel, purified and sequenced. The nucleotide sequence information was used to identify and synthesize an specific oligonucleotide for X. fastidiosa strains that cause Pierce's Disease denominated Xf-1 (5'-CGGGGGTGTAGGAGGGGTTGT-3') which was used jointly with the REP-2 primer at the following conditions: 94 ºC/2 min; 35 X (94 ºC/1 min, 62 ºC/1 min; 72 ºC/1 min and 30 s) 72 ºC/10 min. The DNAs isolated from strains of X. fastidiosa from other hosts [almond (Prumus amygdalus), citrus (Citrus spp.), coffee (Coffea arabica), elm (Ulmus americana), mulberry (Morus rubra), oak (Quercus rubra), periwinkle wilt (Catharantus roseus), plums (Prunus salicina) and ragweed (Ambrosia artemisiifolia)] and also from other Gram negative and positive bacteria were submitted to amplification with a pair of primers Xf-1/REP 2 to verify its specificity. A fragment, about 350 bp, was amplified only when the DNA from strains of X. fastidiosa isolated from grapes was employed.

Hb Köln [a2b298(FG5) val-met] identified by DNA analysis in a Brazilian family

Hb Köln was identified by DNA analysis in a Brazilian patient. A four-year old Brazilian female, with jaundice since birth, presented an abnormal band, between A2 and S, in hemoglobin electrophoresis on a cellulose acetate membrane, and a band with electrophoretic migration similar to Hb C on agar gel. Thermic instability and isopropanol precipitation tests were positive. Heinz bodies were observed in the patient’s peripheral blood. Sequencing of the three exons of the b globin gene detected a transition from G to A in the first position of codon 98. This alteration does not create or abolish any known restriction site. In this case, confirmation of the mutation was accomplished by allele-specific oligonucleotide hybridization, which is a simple and fast identification method when the clinical data and hematological and electrophoretic patterns are suggestive of Hb Köln.

Absence of linkage between MHC and a gene involved in susceptibility to human schistosomiasis

Six hundred million people are at risk of infection by Schistosoma mansoni. MHC haplotypes have been reported to segregate with susceptibility to schistosomiasis in murine models. In humans, a major gene related to susceptibility/resistance to infection by S. mansoni (SM1) and displaying the mean fecal egg count as phenotype was detected by segregation analysis. This gene displayed a codominant mode of inheritance with an estimated frequency of 0.20-0.25 for the deleterious allele and accounted for more than 50% of the variance of infection levels. To determine if the SM1 gene segregates with the human MHC chromosomal region, we performed a linkage study by the lod score method. We typed for HLA-A, B, C, DR and DQ antigens in 11 informative families from an endemic area for schistosomiasis in Bahia, Brazil, by the microlymphocytotoxicity technique. HLA-DR typing by the polymerase chain reaction with sequence-specific primers (PCR-SSP) and HLA-DQ were confirmed by PCR-sequence-specific oligonucleotide probes (PCR-SSOP). The lod scores for the different q values obtained clearly indicate that there is no physical linkage between HLA and SM1 genes. Thus, susceptibility or resistance to schistosomiasis, as defined by mean fecal egg count, is not primarily dependent on the host's HLA profile. However, if the HLA molecule plays an important role in specific immune responses to S. mansoni, this may involve the development of the different clinical aspects of the disease such as granuloma formation and development of hepatosplenomegaly.

Human group C rotavirus in children with diarrhea in the Federal District, Brazil

Group C rotaviruses are fastidious in their in vitro cell culture requirements. Recent serosurveys indicate that antibody to group C rotavirus is present in 3-45% of the human population in certain geographic locations, suggesting that rotavirus group C infection is more prevalent than previously believed and that the low rate of detection of these agents is probably due to the lack of sensitive diagnostic assays. From March to December 1994, 406 fecal specimens were collected from children under five years of age who were outpatients at the emergency services of nine public hospitals in Brasília, Federal District, Brazil. In addition to the samples from children, one public outpatient unit requested virological investigation of a stool sample from an HIV-seropositive adult male with diarrhea of sudden onset. All samples were analyzed by enzyme immunoassay for group A rotavirus and adenovirus (EIARA) and by polyacrylamide gel electrophoresis (PAGE). One hundred and seven (26%) were positive for group A rotavirus. Four samples from children and the sample from the HIV-seropositive patient, although negative by EIARA, showed a group C rotavirus profile by PAGE and were positive for rotavirus by electron microscopy. Using specific VP6 and VP7 primers for group C rotavirus, a reverse transcriptase-polymerase chain reaction (RT-PCR) was performed and products were detected by agarose gel electrophoresis and ethidium bromide staining. These products were confirmed to be specific for group C rotavirus by using digoxigenin-oligonucleotide probes, Southern hybridization and chemiluminescent detection. The five positive group C rotavirus samples were detected in August (3 samples) and September (2 samples). To the best of our knowledge, this is the first report of group C rotavirus detected in the Federal District, Brazil and in an HIV-seropositive patient with acute gastroenteritis.

Detection of point mutations by non-isotopic single strand conformation polymorphism

We have developed a procedure for nonradioactive single strand conformation polymorphism analysis and applied it to the detection of point mutations in the human tumor suppressor gene p53. The protocol does not require any particular facilities or equipment, such as radioactive handling, large gel units for sequencing, or a semiautomated electrophoresis system. This technique consists of amplification of DNA fragments by PCR with specific oligonucleotide primers, denaturation, and electrophoresis on small neutral polyacrylamide gels, followed by silver staining. The sensitivity of this procedure is comparable to other described techniques and the method is easy to perform and applicable to a variety of tissue specimens.

Detection of cytomegalovirus infections by PCR in renal transplant patients

Cytomegalovirus (CMV) is the single most important infectious agent affecting recipients of organ transplants. To evaluate the incidence and the clinical importance of CMV infection in renal transplants in Brazil, 37 patients submitted to renal allograft transplants were tested periodically for the presence of cytomegalovirus DNA in urine using the polymerase chain reaction (PCR), and for the presence of IgM and IgG antibodies against CMV by enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence (IIF). The PCR-amplified products were detected by gel electrophoresis and confirmed by dot-blot hybridization with oligonucleotide probes. Thirty-two of the 37 patients (86.4%) were positive by at least one of the three methods. In six patients, PCR was the only test which detected the probable CMV infection. Ten patients had a positive result by PCR before transplantation. In general, the diagnosis was achieved earlier by PCR than by serologic tests. Active infection occurred more frequently during the first four months after transplantation. Sixteen of the 32 patients (50%) with active CMV infection presented clinical symptoms consistent with CMV infection. Five patients without evidence of active CMV infection by the three tests had only minor clinical manifestations during follow-up. Our results indicate that PCR is a highly sensitive procedure for the early detection of CMV infection and that CMV infection in renal transplant patients is a frequent problem in Brazil.

A simple RT-PCR-based strategy for screening connexin identity

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.