Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Microbial flora in organic honey samples of africanized honeybees from Parana river islands

The purpose of this study was to verify and compare the main contamination sources and the hygienic/sanitary conditions of organic honey samples of Apis mellifera from Parana River islands. Thirty-three (33) samples were analyzed between January 2005 and August 2006. Eleven (11) samples were collected by beekeepers and twenty-two (22) samples were collected and processed in accordance with ideal personal hygiene norms and good manufacturing practices. The samples underwent microbiological analysis in search of coliforms at 35 ºC and 45 ºC, as well as fungi enumeration analysis. As for fungi counting, the samples harvested by beekeepers showed values above the maximum established by Resolution nº 15/94 of Common Market Group - Mercosul. The results showed that secondary contamination sources are responsible for the reduction of organic honey quality.

Physicochemical characteristics of organic honey samples of africanized honeybees from Parana River islands

This research was carried out to evaluate the physicochemical composition of organic honey in Paraná River islands, in Porto Brasílio, State of Paraná. Honey was harvested directly from super of the colonies in three apiaries spread in the Floresta and Laranjeira Islands, from August 2005 to August 2006. Twenty-four samples of organic honey produced by Africanized honeybees were evaluated. The following parameters were analyzed: pH, acidity, formol index, hydroxymethylfurfural, ashes, color, electric conductivity and moisture. Three replications per sample were performed for laboratorial analysis, giving the means and standard deviation. Most honey samples were in conformity with the Normative Instruction 11 from October 20, 2000. However, 4.17% were not in accordance with the moisture standards, 8.33% showed high concentrations of hydroxymethylfurfural, thus, totalizing 12.50% of non-complying samples. Nevertheless, 87.50% of the analyzed honey samples are within the standards, being characterized as an organic product of excellent quality, with good commercialization perspectives in the market.