Non-Linear Unsteady Aerodynamic Response Approximation Using Multi-Layer Functionals

Non-linear functional representation of the aerodynamic response provides a convenient mathematical model for motion-induced unsteady transonic aerodynamic loads response, that accounts for both complex non-linearities and time-history effects. A recent development, based on functional approximation theory, has established a novel functional form; namely, the multi-layer functional. For a large class of non-linear dynamic systems, such multi-layer functional representations can be realised via finite impulse response (FIR) neural networks. Identification of an appropriate FIR neural network model is facilitated by means of a supervised training process in which a limited sample of system input-output data sets is presented to the temporal neural network. The present work describes a procedure for the systematic identification of parameterised neural network models of motion-induced unsteady transonic aerodynamic loads response. The training process is based on a conventional genetic algorithm to optimise the network architecture, combined with a simplified random search algorithm to update weight and bias values. Application of the scheme to representative transonic aerodynamic loads response data for a bidimensional airfoil executing finite-amplitude motion in transonic flow is used to demonstrate the feasibility of the approach. The approach is shown to furnish a satisfactory generalisation property to different motion histories over a range of Mach numbers in the transonic regime.

Wind tunnel simulation of atmospheric boundary layer flows

The present work shows how thick boundary layers can be produced in a short wind tunnel with a view to simulate atmospheric flows. Several types of thickening devices are analysed. The experimental assessment of the devices was conducted by considering integral properties of the flow and the spectra: skin-friction, mean velocity profiles in inner and outer co-ordinates and longitudinal turbulence. Designs based on screens, elliptic wedge generators, and cylindrical rod generators are analysed. The paper describes in detail the experimental arrangement, including the features of the wind tunnel and of the instrumentation. The results are compared with experimental data published by other authors and with naturally developed flows.

Inflammatory response of the spinal cord to multiple episodes of blood-brain barrier disruption and toxic demyelination in Wistar rats

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Effect of high hydrostatic pressure on the barrier properties of polyamide-6 films

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Tumor necrosis factor alpha increases epithelial barrier permeability by disrupting tight junctions in Caco-2 cells

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relationships between dendritic morphology, spatial distribution and firing patterns in rat layer 1 neurons

The cortical layer 1 contains mainly small interneurons, which have traditionally been classified according to their axonal morphology. The dendritic morphology of these cells, however, has received little attention and remains ill defined. Very little is known about how the dendritic morphology and spatial distribution of these cells may relate to functional neuronal properties. We used biocytin labeling and whole cell patch clamp recordings, associated with digital reconstruction and quantitative morphological analysis, to assess correlations between dendritic morphology, spatial distribution and membrane properties of rat layer 1 neurons. A total of 106 cells were recorded, labeled and subjected to morphological analysis. Based on the quantitative patterns of their dendritic arbor, cells were divided into four major morphotypes: horizontal, radial, ascendant, and descendant cells. Descendant cells exhibited a highly distinct spatial distribution in relation to other morphotypes, suggesting that they may have a distinct function in these cortical circuits. A significant difference was also found in the distribution of firing patterns between each morphotype and between the neuronal populations of each sublayer. Passive membrane properties were, however, statistically homogeneous among all subgroups. We speculate that the differences observed in active membrane properties might be related to differences in the synaptic input of specific types of afferent fibers and to differences in the computational roles of each morphotype in layer 1 circuits. Our findings provide new insights into dendritic morphology and neuronal spatial distribution in layer 1 circuits, indicating that variations in these properties may be correlated with distinct physiological functions.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Determining aflatoxins B1, B2, G1 and G2 in maize using florisil clean up with thin layer chromatography and visual and densitometric quantification

A method for determining aflatoxins B1 (AFB1), B2 (AFB2),G1 (AFG1) andG2 (AFG2) in maize with florisil clean up was optimised aiming at one-dimensional thin layer chromatography (TLC) analysis with visual and densitometric quantification. Aflatoxins were extracted with chloroform: water (30:1, v/v), purified through florisil cartridges, separated on TLC plate, detected and quantified by visual and densitometric analysis. The in-house method performance characteristics were determined by using spiked, naturally contaminated maize samples, and certified reference material. The mean recoveries for aflatoxins were 94.2, 81.9, 93.5 and 97.3% in the range of 1.0 to 242 µg/kg for AFB1, 0.3 to 85mg/kg for AFB2, 0.6 to 148mg/kg for AFG1 and 0.6 to 140mg/kg for AFG2, respectively. The correlation values between visual and densitometric analysis for spiked samples were higher than 0.99 for AFB1, AFB2, AFG1 and 0.98 for AFG2. The mean relative standard deviations (RSD) for spiked samples were 16.2, 20.6, 12.8 and 16.9% for AFB1, AFB2, AFG1 and AFG2, respectively. The RSD of the method for naturally contaminated sample (n = 5) was 16.8% for AFB1 and 27.2% for AFB2. The limits of detection of the method (LD) were 0.2, 0.1, 0.1 and 0.1mg/kg and the limits of quantification (LQ) were 1.0, 0.3, 0.6 and 0.6mg/kg for AFB1, AFB2, AFG1 and AFG2, respectively.

Construction of a supercritical fluid extraction (SFE) equipment: validation using annatto and fennel and extract analysis by thin layer chromatography coupled to image

Abstract The present work describes setting up a laboratory unit for supercritical fluid extraction. In addition to its construction, a survey of cost was done to compare the cost of the homemade unit with that of commercial units. The equipment was validated using an extraction of annatto seeds’ oil, and the extraction and fractionation of fennel oil were used to validate the two separators; for both systems, the solvent was carbon dioxide. The chemical profiles of annatto and fennel extracts were assessed using thin layer chromatography; the images of the chromatographic plates were processed using the free ImageJ software. The cost survey showed that the homemade equipment has a very low cost (~US$ 16,000) compared to commercial equipment. The extraction curves of annatto were similar to those obtained in the literature (yield of 3.8% oil). The separators were validated, producing both a 2.5% fraction of fennel seed extract rich in essential oils and another extract fraction composed mainly of oleoresins. The ImageJ software proved to be a low-cost tool for obtaining an initial evaluation of the chemical profile of the extracts.