274 resultados para Normal colonic mucosa


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to determine the levels of TERT mRNA and TERT protein expression in stomach precancerous lesions such as intestinal metaplasia (IM) and gastric ulcer (GU) and compare them to gastric cancer (GC). Real-time PCR was performed to detect TERT mRNA expression levels in 35 biopsies of IM, 30 of GU, and 22 of GC and their respective normal mucosas. TERT protein was detected by immunohistochemistry in 68 samples, 34 of IM, 23 of GU, and 11 of GC. Increased TERT mRNA expression levels were observed in a significant number of cases, i.e., 46% of IM, 50% of GU, and 79% of GC. The relative mean level of TERT mRNA after normalization with the β-actin reference gene and comparison with the respective adjacent normal mucosa was slightly increased in the IM and GU groups, 2.008 ± 2.605 and 2.730 ± 4.120, respectively, but high TERT mRNA expression was observed in the GC group (17.271 ± 33.852). However, there were no statistically significant differences between the three groups. TERT protein-positive immunostaining was observed in 38% of IM, 39% of GU, and 55% of GC. No association of TERT mRNA and protein expression with Helicobacter pylori infection or other clinicopathological variables was demonstrable, except for the incomplete type vs the complete type of IM. This study confirms previous data of the high expression of both TERT mRNA and protein in gastric cancer and also demonstrates this type of changed expression in IM and GU, thus suggesting that TERT expression may be deregulated in precursor lesions that participate in the early stages of gastric carcinogenesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cholangiocarcinomas (CCs) are malignant tumors that originate from epithelial cells lining the biliary tree and gallbladder. Ras correlative C3 creotoxin substrate 1 (Rac1), a small guanosine triphosphatase, is a critical mediator of various aspects of endothelial cell functions. The objective of the present investigation was to study the effect of blocking Rac1 expression in CCs. Seventy-four extrahepatic CC (ECC) specimens and matched adjacent normal mucosa were obtained from the Department of Pathology, Inner Mongolia Medicine Hospital, between 2007 and 2009. Our results showed that the expression of Rac1 was significantly higher (53.12%) in tumor tissues than in normal tissues. Western blotting data indicated a significant reduction in Rac1-miRNA cell protein levels. Rac1-miRNA cell growth rate was significantly different at 24, 48, and 72 h after transfection. Flow cytometry analysis showed that Rac1-miRNA cells undergo apoptosis more effectively than control QBC939 cells. Blocking Rac1 expression by RNAi effectively inhibits the growth of CCs. miRNA silencing of the Rac1 gene suppresses proliferation and induces apoptosis of QBC939 cells. These results suggest that Rac1 may be a new gene therapy target for CC. Blocking Rac1 expression in CC cells induces apoptosis of these tumor cells and may thus represent a new therapeutic approach.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Loss of Y-chromosome has been correlated with older age in males. Furthermore, current evidence indicates that Y-chromosome loss also occurs in several human tumors, including head and neck carcinomas. However, the association between Y nullisomy and the occurrence of neoplasias in elderly men has not been well established. In the present study, the association between Y-chromosome loss and head and neck carcinomas was evaluated by comparison to cells from peripheral blood lymphocytes and normal mucosa of cancer-free individuals matched for age using dual-color fluorescence in situ hybridization. Twenty-one patients ranging in age from 28 to 68 years were divided into five-year groups for comparison with 16 cancer-free individuals matched for age. The medical records of all patients were examined to obtain clinical and histopathological data. None of the patients had undergone radiotherapy or chemotherapy before surgery. In all groups, the frequency of Y-chromosome loss was higher among patients than among normal reference subjects (P < 0.0001) and was not age-dependent. These data suggest that Y-chromosome loss is a tumor-specific alteration not associated with advanced age in head and neck carcinomas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Obesity is a multifactorial disorder often associated with many important diseases such as diabetes, hypertension and other metabolic syndrome conditions. Argyrophil cells represent almost the total population of endocrine cells of the human gastric mucosa and some reports have described changes of specific types of these cells in patients with obesity and metabolic syndrome. The present study was designed to evaluate the global population of argyrophil cells of the gastric mucosa of morbidly obese and dyspeptic non-obese patients. Gastric biopsies of antropyloric and oxyntic mucosa were obtained from 50 morbidly obese patients (BMI >40) and 50 non-obese patients (17 dyspeptic overweight and 33 lean individuals) and processed for histology and Grimelius staining for argyrophil cell demonstration. Argyrophil cell density in the oxyntic mucosa of morbidly obese patients was higher in female (238.68 ± 83.71 cells/mm2) than in male patients (179.31 ± 85.96 cells/mm2) and also higher in female (214.20 ± 50.38 cells/mm2) than in male (141.90 ± 61.22 cells/mm2) morbidly obese patients with metabolic syndrome (P = 0.01 and P = 0.02, respectively). In antropyloric mucosa, the main difference in argyrophil cell density was observed between female morbidly obese patients with (167.00 ± 69.30 cells/mm2) and without (234.00 ± 69.54 cells/mm2) metabolic syndrome (P = 0.001). In conclusion, the present results show that the number of gastric argyrophil cells could be under gender influence in patients with morbid obesity. In addition, gastric argyrophil cells seem to behave differently among female morbidly obese patients with and without metabolic syndrome.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Anastomotic dehiscence is the most severe complication of colorectal surgery. Metalloproteinases (MMPs) and interleukins (ILs) can be used to analyze the healing process of anastomosis. To evaluate the effects of bromopride on MMP and cytokine gene expression in left colonic anastomoses in rats with or without induced abdominal sepsis, 80 rats were divided into two groups for euthanasia on the third or seventh postoperative day (POD). They were then divided into subgroups of 20 rats for sepsis induction or not, and then into subgroups of 10 rats for administration of bromopride or saline. Left colonic anastomosis was performed and abdominal sepsis was induced by cecal ligation and puncture. A colonic segment containing the anastomosis was removed for analysis of gene expression of MMP-1α, MMP-8, MMP-13, IL-β, IL-6, IL-10, tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ). On the third POD, bromopride was associated with increased MMP-1α, MMP-13, IL-6, IFN-γ, and IL-10 gene expression. On the seventh POD, all MMP transcripts became negatively modulated and all IL transcripts became positively modulated. In the presence of sepsis, bromopride administration increased MMP-8 and IFN-γ gene expression and decreased MMP-1, TNF-α, IL-6, and IL-10 gene expression on the third POD. On the seventh POD, we observed increased expression of MMP-13 and all cytokines, except for TNF-α. In conclusion, bromopride interferes with MMP and IL gene expression during anastomotic healing. Further studies are needed to correlate these changes with the healing process.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.