In vitro and in vivo antitumor activity of crude extracts obtained from Brazilian Chromobacterium sp isolates

Natural products produced by microorganisms have been an important source of new substances and lead compounds for the pharmaceutical industry. Chromobacterium violaceum is a Gram-negative β-proteobacterium, abundant in water and soil in tropical and subtropical regions and it produces violacein, a pigment that has shown great pharmaceutical potential. Crude extracts of five Brazilian isolates of Chromobacterium sp (0.25, 2.5, 25, and 250 µg/mL) were evaluated in an in vitro antitumor activity assay with nine human tumor cells. Secondary metabolic profiles were analyzed by liquid chromatography and electrospray ionization mass spectrometry resulting in the identification of violacein in all extracts, whereas FK228 was detected only in EtCE 308 and EtCE 592 extracts. AcCE and EtCE 310 extracts showed selectivity for NCI/ADR-RES cells in the in vitro assay and were evaluated in vivo in the solid Ehrlich tumor model, resulting in 50.3 and 54.6% growth inhibition, respectively. The crude extracts of Chromobacterium sp isolates showed potential and selective antitumor activities for certain human tumor cells, making them a potential source of lead compounds. Furthermore, the results suggest that other compounds, in addition to violacein, deoxyviolacein and FK228, may be involved in the antitumor effect observed.

Propofol exerts anti-inflammatory effects in rats with lipopolysaccharide-induced acute lung injury by inhibition of CD14 and TLR4 expression

We investigated the effect of propofol (Prop) administration (10 mg kg-1 h-1, intravenously) on lipopolysaccharide (LPS)-induced acute lung injury and its effect on cluster of differentiation (CD) 14 and Toll-like receptor (TLR) 4 expression in lung tissue of anesthetized, ventilated rats. Twenty-four male Wistar rats were randomly divided into three groups of 8 rats each: control, LPS, and LPS+Prop. Lung injury was assayed via blood gas analysis and lung histology, and tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) levels were determined in bronchoalveolar lavage fluid using ELISA. Real-time polymerase chain reaction was used to detect CD14 and TLR4 mRNA levels, and CD14 and TLR4 protein expression was determined by Western blot. The pathological scores were 1.2 ± 0.9, 3.3 ± 1.1, and 1.9 ± 1.0 for the control, LPS, and LPS+Prop groups, respectively, with statistically significant differences between control and LPS groups (P < 0.05) and between LPS and LPS+Prop groups (P < 0.05). The administration of LPS resulted in a significant increase in TNF-α and IL-1β levels, 7- and 3.5-fold, respectively (P < 0.05), while treatment with propofol partially blunted the secretion of both cytokines (P < 0.05). CD14 and TLR4 mRNA levels were increased in the LPS group (1.48 ± 0.05 and 1.26 ± 0.03, respectively) compared to the control group (1.00 ± 0.20 and 1.00 ± 0.02, respectively; P < 0.05), while propofol treatment blunted this effect (1.16 ± 0.05 and 1.12 ± 0.05, respectively; P < 0.05). Both CD14 and TLR4 protein levels were elevated in the LPS group compared to the control group (P < 0.05), while propofol treatment partially decreased the expression of CD14 and TLR4 protein versus LPS alone (P < 0.05). Our study indicates that propofol prevents lung injury, most likely by inhibition of CD14 and TLR4 expression.

Ischemia preconditioning is neuroprotective in a rat cerebral ischemic injury model through autophagy activation and apoptosis inhibition

Sublethal ischemic preconditioning (IPC) is a powerful inducer of ischemic brain tolerance. However, its underlying mechanisms are still not well understood. In this study, we chose four different IPC paradigms, namely 5 min (5 min duration), 5×5 min (5 min duration, 2 episodes, 15-min interval), 5×5×5 min (5 min duration, 3 episodes, 15-min intervals), and 15 min (15 min duration), and demonstrated that three episodes of 5 min IPC activated autophagy to the greatest extent 24 h after IPC, as evidenced by Beclin expression and LC3-I/II conversion. Autophagic activation was mediated by the tuberous sclerosis type 1 (TSC1)-mTor signal pathway as IPC increased TSC1 but decreased mTor phosphorylation. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and hematoxylin and eosin staining confirmed that IPC protected against cerebral ischemic/reperfusion (I/R) injury. Critically, 3-methyladenine, an inhibitor of autophagy, abolished the neuroprotection of IPC and, by contrast, rapamycin, an autophagy inducer, potentiated it. Cleaved caspase-3 expression, neurological scores, and infarct volume in different groups further confirmed the protection of IPC against I/R injury. Taken together, our data indicate that autophagy activation might underlie the protection of IPC against ischemic injury by inhibiting apoptosis.

A spheroid-based 3-D culture model for pancreatic cancer drug testing, using the acid phosphatase assay

Current therapy for pancreatic cancer is multimodal, involving surgery and chemotherapy. However, development of pancreatic cancer therapies requires a thorough evaluation of drug efficacy in vitro before animal testing and subsequent clinical trials. Compared to two-dimensional culture of cell monolayer, three-dimensional (3-D) models more closely mimic native tissues, since the tumor microenvironment established in 3-D models often plays a significant role in cancer progression and cellular responses to the drugs. Accumulating evidence has highlighted the benefits of 3-D in vitro models of various cancers. In the present study, we have developed a spheroid-based, 3-D culture of pancreatic cancer cell lines MIAPaCa-2 and PANC-1 for pancreatic drug testing, using the acid phosphatase assay. Drug efficacy testing showed that spheroids had much higher drug resistance than monolayers. This model, which is characteristically reproducible and easy and offers rapid handling, is the preferred choice for filling the gap between monolayer cell cultures and in vivo models in the process of drug development and testing for pancreatic cancer.

Estragole blocks neuronal excitability by direct inhibition of Na+ channels

Estragole is a volatile terpenoid, which occurs naturally as a constituent of the essential oils of many plants. It has several pharmacological and biological activities. The objective of the present study was to investigate the mechanism of action of estragole on neuronal excitability. Intact and dissociated dorsal root ganglion neurons of rats were used to record action potential and Na+ currents with intracellular and patch-clamp techniques, respectively. Estragole blocked the generation of action potentials in cells with or without inflexions on their descendant (repolarization) phase (Ninf and N0 neurons, respectively) in a concentration-dependent manner. The resting potentials and input resistances of Ninf and N0 cells were not altered by estragole (2, 4, and 6 mM). Estragole also inhibited total Na+ current and tetrodotoxin-resistant Na+ current in a concentration-dependent manner (IC50 of 3.2 and 3.6 mM, respectively). Kinetic analysis of Na+ current in the presence of 4 mM estragole showed a statistically significant reduction of fast and slow inactivation time constants, indicating an acceleration of the inactivation process. These data demonstrate that estragole blocks neuronal excitability by direct inhibition of Na+ channel conductance activation. This action of estragole is likely to be relevant to the understanding of the mechanisms of several pharmacological effects of this substance.

RNAi-mediated knockdown of FANCF suppresses cell proliferation, migration, invasion, and drug resistance potential of breast cancer cells

Fanconi anemia complementation group F protein (FANCF) is a key factor, which maintains the function of FA/BRCA, a DNA damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. We performed a specific FANCF-shRNA knockdown of endogenous FANCF in vitro. Cell viability was measured with a CCK-8 assay. DNA damage was assessed with an alkaline comet assay. Apoptosis, cell cycle, and drug accumulation were measured by flow cytometry. The expression levels of protein were determined by Western blot using specific antibodies. Based on these results, we used cell migration and invasion assays to demonstrate a crucial role for FANCF in those processes. FANCF shRNA effectively inhibited expression of FANCF. We found that proliferation of FANCF knockdown breast cancer cells (MCF-7 and MDA-MB-435S) was significantly inhibited, with cell cycle arrest in the S phase, induction of apoptosis, and DNA fragmentation. Inhibition of FANCF also resulted in decreased cell migration and invasion. In addition, FANCF knockdown enhanced sensitivity to doxorubicin in breast cancer cells. These results suggest that FANCF may be a potential target for molecular, therapeutic intervention in breast cancer.

Trypan blue exclusion assay by flow cytometry

Dye exclusion tests are used to determine the number of live and dead cells. These assays are based on the principle that intact plasma membranes in live cells exclude specific dyes, whereas dead cells do not. Although widely used, the trypan blue (TB) exclusion assay has limitations. The dye can be incorporated by live cells after a short exposure time, and personal reliability, related to the expertise of the analyst, can affect the results. We propose an alternative assay for evaluating cell viability that combines the TB exclusion test and the high sensitivity of the flow cytometry technique. Previous studies have demonstrated the ability of TB to emit fluorescence when complexed with proteins. According to our results, TB/bovine serum albumin and TB/cytoplasmic protein complexes emit fluorescence at 660 nm, which is detectable by flow cytometry using a 650-nm low-pass band filter. TB at 0.002% (w/v) was defined as the optimum concentration for distinguishing unstained living cells from fluorescent dead cells, and fluorescence emission was stable for 30 min after cell treatment. Although previous studies have shown that TB promotes green fluorescence quenching, TB at 0.002% did not interfere with green fluorescence in human live T-cells stained with anti-CD3/fluorescein isothiocyanate (FITC) monoclonal antibody. We observed a high correlation between the percentage of propidium iodide+CD3/FITC+ and TB+CD3/FITC+ cells, as well as similar double-stained cell profiles in flow cytometry dot-plot graphs. Taken together, the results indicate that a TB exclusion assay by flow cytometry can be employed as an alternative tool for quick and reliable cell viability analysis.

Therapeutic concentration of morphine reduces oxidative stress in glioma cell line

Morphine is a potent analgesic opioid used extensively for pain treatment. During the last decade, global consumption grew more than 4-fold. However, molecular mechanisms elicited by morphine are not totally understood. Thus, a growing literature indicates that there are additional actions to the analgesic effect. Previous studies about morphine and oxidative stress are controversial and used concentrations outside the range of clinical practice. Therefore, in this study, we hypothesized that a therapeutic concentration of morphine (1 μM) would show a protective effect in a traditional model of oxidative stress. We exposed the C6 glioma cell line to hydrogen peroxide (H2O2) and/or morphine for 24 h and evaluated cell viability, lipid peroxidation, and levels of sulfhydryl groups (an indicator of the redox state of the cell). Morphine did not prevent the decrease in cell viability provoked by H2O2 but partially prevented lipid peroxidation caused by 0.0025% H2O2 (a concentration allowing more than 90% cell viability). Interestingly, this opioid did not alter the increased levels of sulfhydryl groups produced by exposure to 0.0025% H2O2, opening the possibility that alternative molecular mechanisms (a direct scavenging activity or the inhibition of NAPDH oxidase) may explain the protective effect registered in the lipid peroxidation assay. Our results demonstrate, for the first time, that morphine in usual analgesic doses may contribute to minimizing oxidative stress in cells of glial origin. This study supports the importance of employing concentrations similar to those used in clinical practice for a better approximation between experimental models and the clinical setting.

Inhibition of PKC-dependent extracellular Ca2+ entry contributes to the depression of contractile activity in long-term pressure-overloaded endothelium-denuded rat aortas

We examined the contractile responsiveness of rat thoracic aortas under pressure overload after long-term suprarenal abdominal aortic coarctation (lt-Srac). Endothelium-dependent angiotensin II (ANG II) type 2 receptor (AT2R)-mediated depression of contractions to ANG II has been reported in short-term (1 week) pressure-overloaded rat aortas. Contractility was evaluated in the aortic rings of rats subjected to lt-Srac or sham surgery (Sham) for 8 weeks. ANG I and II levels and AT2R protein expression in the aortas of lt-Srac and Sham rats were also evaluated. lt-Srac attenuated the contractions of ANG II and phenylephrine in the aortas in an endothelium-independent manner. However, lt-Srac did not influence the transient contractions induced in endothelium-denuded aortic rings by ANG II, phenylephrine, or caffeine in Ca2+-free medium or the subsequent tonic constrictions induced by the addition of Ca2+ in the absence of agonists. Thus, the contractions induced by Ca2+ release from intracellular stores and Ca2+ influx through stored-operated channels were not inhibited in the aortas of lt-Srac rats. Potassium-elicited contractions in endothelium-denuded aortic rings of lt-Srac rats remained unaltered compared with control tissues. Consequently, the contractile depression observed in aortic tissues of lt-Srac rats cannot be explained by direct inhibition of voltage-operated Ca2+ channels. Interestingly, 12-O-tetradecanoylphorbol-13-acetate-induced contractions in endothelium-denuded aortic rings of lt-Srac rats were depressed in the presence but not in the absence of extracellular Ca2+. Neither levels of angiotensins nor of AT2R were modified in the aortas after lt-Srac. The results suggest that, in rat thoracic aortas, lt-Srac selectively inhibited protein kinase C-mediated activation of contraction that is dependent on extracellular Ca2+ entry.

A combination of STI571 and BCR-ABL1 siRNA with overexpressed p15INK4B induced enhanced proliferation inhibition and apoptosis in chronic myeloid leukemia

p15INK4B, a cyclin-dependent kinase inhibitor, has been recognized as a tumor suppressor. Loss of or methylation of the p15INK4B gene in chronic myeloid leukemia (CML) cells enhances myeloid progenitor formation from common myeloid progenitors. Therefore, we examined the effects of overexpressed p15INK4B on proliferation and apoptosis of CML cells. Overexpression of p15INK4B inhibited the growth of K562 cells by downregulation of cyclin-dependent kinase 4 (CDK4) and cyclin D1 expression. Overexpression of p15INK4B also induced apoptosis of K562 cells by upregulating Bax expression and downregulating Bcl-2 expression. Overexpression of p15INK4B together with STI571 (imatinib) or BCR-ABL1 small interfering RNA (siRNA) also enhanced growth inhibition and apoptosis induction of K562 cells. The enhanced effect was also mediated by reduction of cyclin D1 and CDK4 and regulation of Bax and Bcl-2. In conclusion, our study may provide new insights into the role of p15INK4B in CML and a potential therapeutic target for overcoming tyrosine kinase inhibitor resistance in CML.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

PPARγ induces growth inhibition and apoptosis through upregulation of insulin-like growth factor-binding protein-3 in gastric cancer cells

Peroxisome proliferator activator receptor-gamma (PPARγ) is a ligand-activated transcriptional factor involved in the carcinogenesis of various cancers. Insulin-like growth factor-binding protein-3 (IGFBP-3) is a tumor suppressor gene that has anti-apoptotic activity. The purpose of this study was to investigate the anticancer mechanism of PPARγ with respect to IGFBP-3. PPARγ was overexpressed in SNU-668 gastric cancer cells using an adenovirus gene transfer system. The cells in which PPARγ was overexpressed exhibited growth inhibition, induction of apoptosis, and a significant increase in IGFBP-3 expression. We investigated the underlying molecular mechanisms of PPARγ in SNU-668 cells using an IGFBP-3 promoter/luciferase reporter system. Luciferase activity was increased up to 15-fold in PPARγ transfected cells, suggesting that PPARγ may directly interact with IGFBP-3 promoter to induce its expression. Deletion analysis of the IGFBP-3 promoter showed that luciferase activity was markedly reduced in cells without putative p53-binding sites (-Δ1755, -Δ1795). This suggests that the critical PPARγ-response region is located within the p53-binding region of the IGFBP-3 promoter. We further demonstrated an increase in PPARγ-induced luciferase activity even in cells treated with siRNA to silence p53 expression. Taken together, these data suggest that PPARγ exhibits its anticancer effect by increasing IGFBP-3 expression, and that IGFBP-3 is a significant tumor suppressor.

In vitro biological screening of the anticholinesterase and antiproliferative activities of medicinal plants belonging to Annonaceae

The aim of this research was to investigate the antiproliferative and anticholinesterase activities of 11 extracts from 5 Annonaceae species in vitro. Antiproliferative activity was assessed using 10 human cancer cell lines. Thin-layer chromatography and a microplate assay were used to screen the extracts for acetylcholinesterase (AchE) inhibitors using Ellman's reagent. The chemical compositions of the active extracts were investigated using high performance liquid chromatography. Eleven extracts obtained from five Annonaceae plant species were active and were particularly effective against the UA251, NCI-470 lung, HT-29, NCI/ADR, and K-562 cell lines with growth inhibition (GI50) values of 0.04-0.06, 0.02-0.50, 0.01-0.12, 0.10-0.27, and 0.02-0.04 µg/mL, respectively. In addition, the Annona crassiflora and A. coriacea seed extracts were the most active among the tested extracts and the most effective against the tumor cell lines, with GI50 values below 8.90 µg/mL. The A. cacans extract displayed the lowest activity. Based on the microplate assay, the percent AchE inhibition of the extracts ranged from 12 to 52%, and the A. coriacea seed extract resulted in the greatest inhibition (52%). Caffeic acid, sinapic acid, and rutin were present at higher concentrations in the A. crassiflora seed samples. The A. coriacea seeds contained ferulic and sinapic acid. Overall, the results indicated that A. crassiflora and A. coriacea extracts have antiproliferative and anticholinesterase properties, which opens up new possibilities for alternative pharmacotherapy drugs.

Propofol inhibits burn injury-induced hyperpermeability through an apoptotic signal pathway in microvascular endothelial cells

Recent studies have revealed that an intrinsic apoptotic signaling cascade is involved in vascular hyperpermeability and endothelial barrier dysfunction. Propofol (2,6-diisopropylphenol) has also been reported to inhibit apoptotic signaling by regulating mitochondrial permeability transition pore (mPTP) opening and caspase-3 activation. Here, we investigated whether propofol could alleviate burn serum-induced endothelial hyperpermeability through the inhibition of the intrinsic apoptotic signaling cascade. Rat lung microvascular endothelial cells (RLMVECs) were pretreated with propofol at various concentrations, followed by stimulation with burn serum, obtained from burn-injury rats. Monolayer permeability was determined by transendothelial electrical resistance. Mitochondrial release of cytochrome C was measured by ELISA. Bax and Bcl-2 expression and mitochondrial release of second mitochondrial-derived activator of caspases (smac) were detected by Western blotting. Caspase-3 activity was assessed by fluorometric assay; mitochondrial membrane potential (Δψm) was determined with JC-1 (a potential-sensitive fluorescent dye). Intracellular ATP content was assayed using a commercial kit, and reactive oxygen species (ROS) were measured by dichlorodihydrofluorescein diacetate (DCFH-DA). Burn serum significantly increased monolayer permeability (P<0.05), and this effect could be inhibited by propofol (P<0.05). Compared with a sham treatment group, intrinsic apoptotic signaling activation - indicated by Bax overexpression, Bcl-2 downregulation, Δψm reduction, decreased intracellular ATP level, increased cytosolic cytochrome C and smac, and caspase-3 activation - was observed in the vehicle group. Propofol not only attenuated these alterations (P<0.05 for all), but also significantly decreased burn-induced ROS production (P<0.05). Propofol attenuated burn-induced RLMVEC monolayer hyperpermeability by regulating the intrinsic apoptotic signaling pathway.

Silibinin improves palmitate-induced insulin resistance in C2C12 myotubes by attenuating IRS-1/PI3K/Akt pathway inhibition

The present study investigated the effect of silibinin, the principal potential anti-inflammatory flavonoid contained in silymarin, a mixture of flavonolignans extracted from Silybum marianum seeds, on palmitate-induced insulin resistance in C2C12 myotubes and its potential molecular mechanisms. Silibinin prevented the decrease of insulin-stimulated 2-NBDG (2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose) uptake and the downregulation of glutamate transporter type 4 (GLUT4) translocation in C2C12 myotubes induced by palmitate. Meanwhile, silibinin suppressed the palmitate-induced decrease of insulin-stimulated Akt Ser473 phosphorylation, which was reversed by wortmannin, a specific inhibitor of phosphatidylinositol-3-kinase (PI3K). We also found that palmitate downregulated insulin-stimulated Tyr632 phosphorylation of insulin receptor substrate 1 (IRS-1) and up-regulated IRS-1 Ser307 phosphorylation. These effects were rebalanced by silibinin. Considering several serine/threonine kinases reported to phosphorylate IRS-1 at Ser307, treatment with silibinin downregulated the phosphorylation of both c-Jun N-terminal kinase (JNK) and nuclear factor-κB kinase β (IKKβ), which was increased by palmitate in C2C12 myotubes mediating inflammatory status, whereas the phosphorylation of PKC-θ was not significantly modulated by silibinin. Collectively, the results indicated that silibinin prevented inhibition of the IRS-1/PI3K/Akt pathway, thus ameliorating palmitate-induced insulin resistance in C2C12 myotubes.