Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Performance of different drying methods and their effects on the physiological quality of grain sorghum seeds (S. bicolor (L.) Moench)

This experiment viewed to evaluate the physiological quality of grain sorghum seeds as well as to determine the respective drying curve of each of three drying methods. The seeds harvested at 18.9%, 18.1%, and 18.2% of moisture content were submitted to the following drying methods : a) under natural conditions, b) an intermittent dryer in which the combustion of firewood was the source of caloric energy, and c) a stationary dryer in which the source of caloric energy was the burning of liquefied petroleum gas. The experimental design was a completely randomized one with 25 repetitions of one hundred seeds each. The water contents and weight of one thousand seeds were evaluated. Seeds physiological quality was evaluated by germination and vigor tests. Seed drying rates were of 0.11, 1.25, and 0.55 percent points per hour (pph -1) for the natural, intermittent and stationary drying methods, respectively. The intermittent treatment permits the highest loss of water in the shortest period of time, and germination and vigor remaining unchanged.