Amniotic fluid amino acid levels in non-immune hydrops fetalis: a case-control study

In a prospective case-control study, we compared the amniotic fluid amino acid levels in non-immune hydrops fetalis (NIHF) and normal fetuses. Eighty fetuses underwent amniocentesis for different reasons at the prenatal diagnosis unit of the Department of Obstetrics and Gynecology, Faculty of Medicine, Dicle University. Forty of these fetuses were diagnosed with NIHF. The study included 40 women each in the NIHF (mean age: 27.69 ± 4.56 years) and control (27.52 ± 5.49 years) groups, who had abnormal double- or triple-screening test values with normal fetuses with gestational ages of 23.26 ± 1.98 and 23.68 ± 1.49 weeks at the time of sample collection, respectively. Amniotic fluid amino acid concentrations (intra-assay variation: 2.26-7.85%; interassay variation: 3.45-8.22%) were measured using EZ:faast kits (EZ:faast GC/FID free (physiological) amino acid kit; Phenomenex, USA) by gas chromatography. The standard for quantitation was a mixture of free amino acids from Phenomenex. The levels of 21 amino acids were measured. The mean phosphoserine and serine levels were significantly lower in the NIHF group, while the taurine, α-aminoadipic acid (aaa), glycine, cysteine, NH4, and arginine (Arg) levels were significantly higher compared to control. Significant risk variables for the NIHF group and odds coefficients were obtained using a binary logistic regression method. The respective odds ratios and 95% confidence intervals for the risk variables phosphoserine, taurine, aaa, Arg, and NH4 were 3.31 (1.84-5.97), 2.45 (1.56-3.86), 1.78 (1.18-2.68), 2.18 (1.56-3.04), and 2.41 (1.66-3.49), respectively. The significant difference between NIHF and control fetuses suggests that the amniotic fluid levels of some amino acids may be useful for the diagnosis of NIHF.

Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Animal models of prenatal immune challenge and their contribution to the study of schizophrenia: a systematic review

Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.

Compounds used to produce cloned animals are genotoxic and mutagenic in mammalian assays in vitro and in vivo

The compounds 6-dimethylaminopurine and cycloheximide promote the successful production of cloned mammals and have been used in the development of embryos produced by somatic cell nuclear transfer. This study investigated the effects of 6-dimethylaminopurine and cycloheximide in vitro, using the thiazolyl blue tetrazolium bromide colorimetric assay to assess cytotoxicity, the trypan blue exclusion assay to assess cell viability, the comet assay to assess genotoxicity, and the micronucleus test with cytokinesis block to test mutagenicity. In addition, the comet assay and the micronucleus test were also performed on peripheral blood cells of 54 male Swiss mice, 35 g each, to assess the effects of the compounds in vivo. The results indicated that both 6-dimethylaminopurine and cycloheximide, at the concentrations and doses tested, were cytotoxic in vitro and genotoxic and mutagenic in vitro and in vivo, altered the nuclear division index in vitro, but did not diminish cell viability in vitro. Considering that alterations in DNA play important roles in mutagenesis, carcinogenesis, and morphofunctional teratogenesis and reduce embryonic viability, this study indicated that 6-dimethylaminopurine and cycloheximide utilized in the process of mammalian cloning may be responsible for the low embryo viability commonly seen in nuclear transfer after implantation in utero.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Sequence analysis of the 5′ third of glycoprotein C gene of South American bovine herpesviruses 1 and 5

Bovine herpesviruses 1 (BoHV-1) and 5 (BoHV-5) share high genetic and antigenic similarities, but exhibit marked differences in tissue tropism and neurovirulence. The amino-terminal region of glycoprotein C (gC), which is markedly different in each of the viruses, is involved in virus binding to cellular receptors and in interactions with the immune system. This study investigated the genetic and antigenic differences of the 5′ region of the gC (5′ gC) gene (amino-terminal) of South American BoHV-1 (n=19) and BoHV-5 (n=25) isolates. Sequence alignments of 374 nucleotides (104 amino acids) revealed mean similarity levels of 97.3 and 94.2% among BoHV-1 gC (gC1), respectively, 96.8 and 95.6% among BoHV-5 gC (gC5), and 62 and 53.3% between gC1 and gC5. Differences included the absence of 40 amino acid residues (27 encompassing predicted linear epitopes) scattered throughout 5′ gC1 compared to 5′ gC5. Virus neutralizing assays testing BoHV-1 and BoHV-5 antisera against each isolate revealed a high degree of cross-neutralization between the viruses, yet some isolates were neutralized at very low titers by heterologous sera, and a few BoHV-5 isolates reacted weakly with either sera. The virus neutralization differences observed within the same viral species, and more pronounced between BoHV-1 and BoHV-5, likely reflect sequence differences in neutralizing epitopes. These results demonstrate that the 5′ gC region is well conserved within each viral species but is divergent between BoHV-1 and BoHV-5, likely contributing to their biological and antigenic differences.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Cocaine/levamisole-induced systemic vasculitis with retiform purpura and pauci-immune glomerulonephritis

Levamisole has been increasingly used as an adulterant of cocaine in recent years, emerging as a public health challenge worldwide. Levamisole-associated toxicity manifests clinically as a systemic vasculitis, consisting of cutaneous, hematological, and renal lesions, among others. Purpura retiform, cutaneous necrosis, intravascular thrombosis, neutropenia, and less commonly crescentic nephritis have been described in association with anti-neutrophil cytoplasmic antibodies (ANCAs) and other autoantibodies. Here we report the case of a 49-year-old male who was a chronic cocaine user, and who presented spontaneous weight loss, arthralgia, and 3 weeks before admission purpuric skin lesions in the earlobes and in the anterior thighs. His laboratory tests on admission showed serum creatinine of 4.56 mg/dL, white blood count 3,800/μL, hemoglobin 7.3 g/dL, urinalysis with 51 white blood cells/μL and 960 red blood cells/μL, and urine protein-to-creatinine ratio 1.20. Serum ANCA testing was positive (>1:320), as well as serum anti-myeloperoxidase and anti-proteinase 3 antibodies. Urine toxicology screen was positive for cocaine and levamisole, with 62.8% of cocaine, 32.2% of levamisole, and 5% of an unidentified substance. Skin and renal biopsies were diagnostic for leukocytoclastic vasculitis and pauci-immune crescentic glomerulonephritis, respectively. The patient showed a good clinical response to cocaine abstinence, and use of corticosteroids and intravenous cyclophosphamide. Last serum creatinine was 1.97 mg/dL, white blood cell count 7,420/μL, and hemoglobin level 10.8 g/dL. In levamisole-induced systemic vasculitis, the early institution of cocaine abstinence, concomitant with the use of immunosuppressive drugs in severe cases, may prevent permanent end organ damage and associate with better clinical outcomes.