Effect of TNF-α production inhibitors on the production of pro-inflammatory cytokines by peripheral blood mononuclear cells from HTLV-1-infected individuals

Human T lymphotropic virus type 1 (HTLV-1) is the causal agent of myelopathy/tropical spastic paraparesis (HAM/TSP), a disease mediated by the immune response. HTLV-1 induces a spontaneous proliferation and production of pro-inflammatory cytokines by T cells, and increasing interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) levels are potentially involved in tissue damage in diseases related to HTLV-1. This exaggerated immune response is also due to an inability of the natural regulatory mechanisms to down-modulate the immune response in this group of patients. TNF-α inhibitors reduce inflammation and have been shown to improve chronic inflammatory diseases in clinical trials. The aim of this study was to evaluate the ability of pentoxifylline, forskolin, rolipram, and thalidomide to decrease in vitro production of TNF-α and IFN-γ in cells of HTLV-1-infected subjects. Participants of the study included 19 patients with HAM/TSP (mean age, 53 ± 11; male:female ratio, 1:1) and 18 HTLV-1 carriers (mean age, 47 ± 11; male:female ratio, 1:2.6). Cytokines were determined by ELISA in supernatants of mononuclear cell cultures. Pentoxifylline inhibited TNF-α and IFN-γ synthesis with the minimum dose used (50 µM). The results with forskolin were similar to those observed with pentoxifylline. The doses of rolipram used were 0.01-1 µM and the best inhibition of TNF-α production was achieved with 1 µM and for IFN-γ production it was 0.01 µM. The minimum dose of thalidomide used (1 µM) inhibited TNF-α production but thalidomide did not inhibit IFN-γ production even when the maximum dose (50 µM) was used. All drugs had an in vitro inhibitory effect on TNF-α production and, with the exception of thalidomide, all of them also decreased IFN-γ production.

Expression of the chemokine receptor CXCR4 on lymphocytes of leprosy patients

Leprosy is caused by Mycobacterium leprae, which induces chronic granulomatous infection of the skin and peripheral nerves. The disease ranges from the tuberculoid to the lepromatous forms, depending on the cellular immune response of the host. Chemokines are thought to be involved in the immunopathogenesis of leprosy, but few studies have investigated the expression of chemokine receptors on leukocytes of leprosy patients. In the present study, we evaluated 21 leprosy patients (M/F: 16/5) with a new diagnosis from the Dermatology Outpatient Clinic of the University Hospital, Federal University of Minas Gerais. The control group was composed of 20 healthy members (M/F: 15/5) of the community recruited by means of announcements. The expression of CCR2, CCR3, CCR5, and CXCR4 was investigated by flow cytometry on the surface of peripheral blood lymphocytes. There was a decrease in percentage of CD3+CXCR4+ and CD4+CXCR4+ lymphocytes in the peripheral blood of leprosy patients (median [range], 17.6 [2.7-41.9] and 65.3 [3.9-91.9], respectively) compared to the control group (median [range], 43.0 [3.7-61.3] and 77.2 [43.6-93.5], respectively). The percentage of CD4+CXCR4+ was significantly lower in patients with the tuberculoid form (median [range], 45.7 [0.0-83.1]) of the disease, but not in lepromatous patients (median [range], 81.5 [44.9-91.9]). The CXCR4 chemokine receptor may play a role in leprosy immunopathogenesis, probably directing cell migration to tissue lesions in tuberculoid leprosy patients.

Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Animal models of prenatal immune challenge and their contribution to the study of schizophrenia: a systematic review

Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.

Acute effects of resistance exercise and intermittent intense aerobic exercise on blood cell count and oxidative stress in trained middle-aged women

The aim of this study was to compare the effect of an intermittent intense aerobic exercise session and a resistance exercise session on blood cell counts and oxidative stress parameters in middle-aged women. Thirty-four women were selected and divided into three groups: RE group (performing 60 min of resistance exercises, N = 12), spinning group (performing 60 min of spinning, N = 12), and control group (not exercising regularly, N = 10). In both exercise groups, lymphocytes and monocytes decreased after 1-h recuperation (post-exercise) compared to immediately after exercise (P < 0.05). Immediately after exercise, in both exercised groups, a significant increase in TBARS (from 16.5 ± 2 to 25 ± 2 for the spinning group and from 18.6 ± 1 to 28.2 ± 3 nmol MDA/mL serum for the RE group) and protein carbonyl (from 1.0 ± 0.3 to 1.6 ± 0.2 for the spinning group and from 0.9 ± 0.2 to 1.5 ± 0.2 nmol/mg protein for the RE group) was observed (P < 0.05). A decrease in antioxidant activities (non-protein sulfhydryl, superoxide dismutase, catalase) was also demonstrated with a negative correlation between damage markers and antioxidant body defenses (P < 0.05). These results indicate that an acute bout of intermittent or anaerobic exercise induces immune suppression and increases the production of reactive oxygen species, causing oxidative stress in middle-aged and trained women. Furthermore, we demonstrated that trained women show improved antioxidant capacity and lower oxidative damage than sedentary ones, demonstrating the benefits of chronic regular physical activity.

Proteomic data show an increase in autoantibodies and alpha-fetoprotein and a decrease in apolipoprotein A-II with time in sera from senescence-accelerated mice

We evaluated changes in levels by comparing serum proteins in senescence-accelerated mouse-prone 8 (SAMP8) mice at 2, 6, 12, and 15 months of age (SAMP8-2 m, -6 m, -12 m, -15 m) to age-matched SAM-resistant 1 (SAMR1) mice. Mice were sacrificed, and blood was analyzed by 2-dimensional electrophoresis combined with mass spectrometry. Five protein spots were present in all SAMP8 serum samples, but only appeared in SAMR1 samples at 15 months of age except for spot 3, which also showed a slight expression in SAMR1-12 m sera. Two proteins decreased in the sera from SAMP8-2 m, -6 m, and -12 m mice, and divided into 2 spots each in SAMP8-15 m sera. Thus, the total number of altered spots in SAMP8 sera was 7; of these, 4 were identified as Ig kappa chain V region (M-T413), chain A of an activity suppressing Fab fragment to cytochrome P450 aromatase (32C2_A), alpha-fetoprotein, and apolipoprotein A-II. M-T413 is a monoclonal CD4 antibody, which inhibits T cell proliferation. We found that M-T413 RNA level was significantly enhanced in splenocytes from SAMP8-2 m mice. This agreed with serum M-T413 protein alterations and a strikingly lower blood CD4+ T cell count in SAMP8 mice when compared to the age-matched SAMR1 mice, with the latter negatively correlating with serum M-T413 protein volume. Age-related changes in serum proteins favored an increase in autoantibodies and alpha-fetoprotein and a decrease of apolipoprotein A-II, which occurred in SAMP8 mice at 2 months of age and onwards. These proteins may serve as candidate biomarkers for early aging.

Imbalanced expression of functional surface molecules in regulatory and effector T cells in systemic lupus erythematosus

Regulatory T (TREG) cells play an important role in maintaining immune tolerance and avoiding autoimmunity. We analyzed the expression of membrane molecules in TREG and effector T cells in systemic lupus erythematosus (SLE). TREG and effector T cells were analyzed for the expression of CTLA-4, PD1, CD28, CD95, GITR, HLA-DR, OX40, CD40L, and CD45RO in 26 patients with active disease, 31 with inactive disease, and 26 healthy controls. TREG cells were defined as CD25+/highCD127Ø/lowFoxP3+, and effector T cells were defined as CD25+CD127+FoxP3Ø. The ratio of TREG to effector T cells expressing GITR, PD1, HLA-DR, OX40, CD40L, and CD45RO was determined in the three groups. The frequency of TREG cells was similar in patients with SLE and controls. However, SLE patients had a decreased frequency of CTLA-4+TREG and CD28+TREG cells and an increased frequency of CD40L+TREG cells. There was a decrease in the TREG/effector-T ratio for GITR+, HLA-DR+, OX40+, and CD45RO+ cells, and an increased ratio of TREG/effector-T CD40L+ cells in patients with SLE. In addition, CD40L+TREG cell frequency correlated with the SLE disease activity index (P=0.0163). In conclusion, our findings showed several abnormalities in the expression of functionally critical surface molecules in TREG and effector T cells in SLE that may be relevant to the pathogenesis of this disease.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Dexmedetomidine decreases the inflammatory response to myocardial surgery under mini-cardiopulmonary bypass

Cardiopulmonary bypass (CPB) with extracorporeal circulation produces changes in the immune system accompanied by an increase in proinflammatory cytokines and a decrease in anti-inflammatory cytokines. We hypothesize that dexmedetomidine (DEX) as an anesthetic adjuvant modulates the inflammatory response after coronary artery bypass graft surgery with mini-CPB. In a prospective, randomized, blind study, 12 patients (4 females and 8 males, age range 42-72) were assigned to DEX group and compared with a conventional total intravenous anesthesia (TIVA) group of 11 patients (4 females and 7 males). The endpoints used to assess inflammatory and biochemical responses to mini-CPB were plasma interleukin (IL)-1, IL-6, IL-10, interferon (INF)-γ, tumor necrosis factor (TNF)-α, C-reactive protein, creatine phosphokinase, creatine phosphokinase-MB, cardiac troponin I, cortisol, and glucose levels. These variables were determined before anesthesia, 90 min after beginning CPB, 5 h after beginning CPB, and 24 h after the end of surgery. Endpoints of oxidative stress, including thiobarbituric acid reactive species and delta-aminolevulinate dehydratase activity in erythrocytes were also determined. DEX+TIVA use was associated with a significant reduction in IL-1, IL-6, TNF-α, and INF-γ (P<0.0001) levels compared with TIVA (two-way ANOVA). In contrast, the surgery-induced increase in thiobarbituric acid reactive species was higher in the DEX+TIVA group than in the TIVA group (P<0.01; two-way ANOVA). Delta-aminolevulinate dehydratase activity was decreased after CPB (P<0.001), but there was no difference between the two groups. DEX as an adjuvant in anesthesia reduced circulating IL-1, IL-6, TNF-α, and INF-γ levels after mini-CPB. These findings indicate an interesting anti-inflammatory effect of DEX, which should be studied in different types of surgical interventions.

Cocaine/levamisole-induced systemic vasculitis with retiform purpura and pauci-immune glomerulonephritis

Levamisole has been increasingly used as an adulterant of cocaine in recent years, emerging as a public health challenge worldwide. Levamisole-associated toxicity manifests clinically as a systemic vasculitis, consisting of cutaneous, hematological, and renal lesions, among others. Purpura retiform, cutaneous necrosis, intravascular thrombosis, neutropenia, and less commonly crescentic nephritis have been described in association with anti-neutrophil cytoplasmic antibodies (ANCAs) and other autoantibodies. Here we report the case of a 49-year-old male who was a chronic cocaine user, and who presented spontaneous weight loss, arthralgia, and 3 weeks before admission purpuric skin lesions in the earlobes and in the anterior thighs. His laboratory tests on admission showed serum creatinine of 4.56 mg/dL, white blood count 3,800/μL, hemoglobin 7.3 g/dL, urinalysis with 51 white blood cells/μL and 960 red blood cells/μL, and urine protein-to-creatinine ratio 1.20. Serum ANCA testing was positive (>1:320), as well as serum anti-myeloperoxidase and anti-proteinase 3 antibodies. Urine toxicology screen was positive for cocaine and levamisole, with 62.8% of cocaine, 32.2% of levamisole, and 5% of an unidentified substance. Skin and renal biopsies were diagnostic for leukocytoclastic vasculitis and pauci-immune crescentic glomerulonephritis, respectively. The patient showed a good clinical response to cocaine abstinence, and use of corticosteroids and intravenous cyclophosphamide. Last serum creatinine was 1.97 mg/dL, white blood cell count 7,420/μL, and hemoglobin level 10.8 g/dL. In levamisole-induced systemic vasculitis, the early institution of cocaine abstinence, concomitant with the use of immunosuppressive drugs in severe cases, may prevent permanent end organ damage and associate with better clinical outcomes.