Functional complementation of Leishmania (Leishmania) amazonensis AP endonuclease gene (lamap) in Escherichia coli mutant strains challenged with DNA damage agents

During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.

A non-enteric adenovirus A12 gastroenteritis outbreak in Rio de Janeiro, Brazil

A gastroenteritis outbreak that occurred in 2013 in a low-income community in Rio de Janeiro was investigated for the presence of enteric viruses, including species A rotavirus (RVA), norovirus (NoV), astrovirus (HAstV), bocavirus (HBoV), aichivirus (AiV), and adenovirus (HAdV). Five of nine stool samples (83%) from patients were positive for HAdV, and no other enteric viruses were detected. Polymerase chain reaction products were sequenced and subjected to phylogenetic analysis, which revealed four strains and one strain of non-enteric HAdV-A12 and HAdV-F41, respectively. The HAdV-A12 nucleotide sequences shared 100% nucleotide similarity. Viral load was assessed using a TaqMan real-time PCR assay. Stool samples that were positive for HAdV-A12 had high viral loads (mean 1.9 X 107 DNA copies/g stool). All four patients with HAdV-A12 were < 25 months of age and had symptoms of fever and diarrhoea. Evaluation of enteric virus outbreaks allows the characterisation of novel or unique diarrhoea-associated viruses in regions where RVA vaccination is routinely performed.

Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identificación basada en DNA-barcoding y notas morfológicas e historia de vida de los estados inmaduros

Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identification based on DNA-barcoding and notes on the morphology and life history of the immature stages. The larva morphology of the species Heterobathmia pseuderiocrania (Lepidoptera, Heterobathmiidae), a Nothofagus obliqua leafminer in Chile, is described. The tissue-feeding first and last instars are described. Also, the number of larval stages, some aspects of the biology and life cycle of the species are provided.

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

Caracterização do dna ribossômico do isolado de Scleroderma UFSMSc1 de Eucalyptus grandis W. Hill ex-maiden

O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.

Molecular biology of baculovirus and its use in biological control in Brazil

Baculoviruses are insect viruses found mainly in Lepidoptera. The family Baculoviridae is taxonomically divided in two genera, Nucleopolyhedrovirus and Granulovirus, which differ by occlusion body morphology. NPVs (Nucleopolyhedroviruses) have polyhedrical inclusion bodies (PIBs) containing multiple viral particles, while GVs (Granuloviruses) appear to be generally single particles occluded in oval shaped occlusion bodies. During the life cycle, two different viral progenies are produced: BV (Budded Virus) and PDV (Polyhedra Derived Virus), which are essential for the infectious process and virus propagation in host cells. Baculoviruses are being used for pest control and they are especially safe due to their specificity and invertebrate-restricted host range. Baculoviruses have been used as vectors for high level protein expression ofheterologous genes from prokaryotic and eukaryotic organisms. Also, recombinant DNA techniques have allowed the production of genetically modified viral insecticides. This study is a review on the taxonomy, structure, replication and molecular biology of baculoviruses, as well as their use as bioinsecticides in Brazil.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Mitochondrial DNA of Nellore and European x Nellore crossing cattle of high performance

The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.

DNA barcodes for soil animal taxonomy

The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.

Simple and multiple resistances to viruses in cowpea genotypes

The objective of this work was to identify new sources of simple and multiple resistances to Cowpea severe mosaic virus (CPSMV), Cowpea aphid-borne mosaic virus (CABMV) and Cucumber mosaic virus (CMV) isolates in cowpea (Vigna unguiculata). Thirty-three genotypes from the germplasm bank of Universidade Federal do Ceará were tested as to their resistance to four CPSMV isolates, two CABMV isolates and one CMV isolate. Twenty-five days after the first virus inoculations, all inoculated plants, including the asymptomatic ones, were tested by serology. Genotypes were classified as: immune, plants without symptoms and negative serology; resistant, plants with mild mosaic and positive serology; susceptible, plants with mosaic and positive serology; and highly susceptible, plants with severe mosaic, other systemic symptoms, including systemic necrosis, and positive serology. Simple and multiple resistances to viruses were identified among the evaluated genotypes, but none of them showed multiple immunities to all isolates. Four genotypes showed immunity to all CPSMV isolates, two were immune to CABMV and two showed immunity to CMV. Eleven genotypes showed multiple resistances to two viruses, allowing for the development of new cultivars with more stable and broader resistance. Genotypes Purple Knuckle Hull-55, MNC-03-731C-21 and CNCx284-66E show resistance to CABMV, even when inoculated with CMV.

EXTRAÇÃO DE DNA GENÔMICO DE Passiflora spp. PARA ANÁLISES PCR-RAPD

A identificação e caracterização da diversidade genética de plantas por meio de técnicas moleculares envolvem a avaliação de vários indivíduos, necessitando-se, portanto, de métodos rápidos e precisos de extração do DNA. O co-isolamento de polissacarídeos, fenóis e compostos secundários é o principal problema encontrado no isolamento e purificação de DNA vegetal. Folhas das diversas espécies de Passiflora possuem níveis variados desses compostos que podem comprometer este procedimento. O presente estudo foi realizado com o objetivo de avaliar a qualidade e quantidade de DNA de folhas de variedades de Passiflora spp., utilizando-se de três métodos de extração. Os três métodos forneceram DNA em qualidade e quantidade suficientes para a realização da técnica PCR-RAPD.

Identificação de microssatélites para o mamoeiro por meio da exploração do banco de dados de DNA

Os marcadores microssatélites são ferramentas úteis em diversas análises genéticas em plantas. No caso do mamoeiro (Carica papaya L.), poucos locos de microssatélites foram descritos até o momento. Assim, o objetivo deste trabalho foi explorar a base de dados do GenBank / NCBI (National Center of Biotechnoloy Information) à procura de microssatélites de mamoeiro, visando a seu futuro uso em estudos genéticos e moleculares aplicados ao melhoramento genético. As seqüências foram obtidas no GenBank / NCBI, no formato FASTA, e analisadas para a presença de microssatélites com um mínimo de 20; 7 e 5 repetições dos motivos de mono-, di- e trinucleotídeos, respectivamente, e acima de 4 repetições para tetra- e pentanucleotídeos. Seqüências com mais de 90% de similaridade foram consideradas redundantes e, portanto, eliminadas das análises. Foram analisadas 44.591 seqüências, das quais 3.180 foram não-redundantes e apresentaram 3.947 microssatélites. Desse total, 3.587 foram classificados como microssatélites perfeitos, 8 imperfeitos, 65 interrompidos, 239 compostos-perfeitos, 8 compostos-imperfeitos e 40 compostos-interrompidos. As repetições de di- e trinucleotídeos representaram 65,7 e 14,4% do total de seqüências analisadas, respectivamente. Somente os motivos do tipo AT/TA representaram 44,1% dos microssatélites encontrados. Os motivos mais comuns de tri-, tetra- e pentanucleotídeos foram AAT, AATT e TTTAA, respectivamente. Observou-se que, nas seqüências disponíveis, o genoma do mamoeiro apresenta, em média, um microssatélite a cada 5,65 kb.