Diagnostic reliability of an immunochromatographic test for Chagas disease screening at a primary health care centre in a rural endemic area

Many patients with Chagas disease live in remote communities that lack both equipment and trained personnel to perform a diagnosis by conventional serology (CS). Thus, reliable tests suitable for use under difficult conditions are required. In this study, we evaluated the ability of personnel with and without laboratory skills to perform immunochromatographic (IC) tests to detect Chagas disease at a primary health care centre (PHCC). We examined whole blood samples from 241 patients and serum samples from 238 patients. Then, we calculated the percentage of overall agreement (POA) between the two groups of operators for the sensitivity (S), specificity (Sp) and positive (PPV) and negative (NPV) predictive values of IC tests compared to CS tests. We also evaluated the level of agreement between ELISAs and indirect haemagglutination (IHA) tests. The readings of the IC test results showed 100% agreement (POA = 1). The IC test on whole blood showed the following values: S = 87.3%; Sp = 98.8%; PPV = 96.9% and NPV = 95.9%. Additionally, the IC test on serum displayed the following results: S = 95.7%; Sp = 100%; PPV = 100% and NPV = 98.2%. Using whole blood, the agreement with ELISA was 96.3% and the agreement with IHA was 94.1%. Using serum, the agreement with ELISA was 97.8% and the agreement with IHA was 96.6%. The IC test performance with serum samples was excellent and demonstrated its usefulness in a PHCC with minimal equipment. If the IC test S value and NPV with whole blood are improved, then this test could also be used in areas lacking laboratories or specialised personnel.

Mycobacterium tuberculosis epitope-specific interferon-g production in healthy Brazilians reactive and non-reactive to tuberculin skin test

The interferon (IFN)-γ response to peptides can be a useful diagnostic marker of Mycobacterium tuberculosis (MTB) latent infection. We identified promiscuous and potentially protective CD4+ T-cell epitopes from the most conserved regions of MTB antigenic proteins by scanning the MTB antigenic proteins GroEL2, phosphate-binding protein 1 precursor and 19 kDa antigen with the TEPITOPE algorithm. Seven peptide sequences predicted to bind to multiple human leukocyte antigen (HLA)-DR molecules were synthesised and tested with IFN-γ enzyme-linked immunospot (ELISPOT) assays using peripheral blood mononuclear cells (PBMCs) from 16 Mantoux tuberculin skin test (TST)-positive and 16 TST-negative healthy donors. Eighty-eight percent of TST-positive donors responded to at least one of the peptides, compared to 25% of TST-negative donors. Each individual peptide induced IFN-γ production by PBMCs from at least 31% of the TST-positive donors. The magnitude of the response against all peptides was 182 ± 230 x 106 IFN-γ spot forming cells (SFC) among TST-positive donors and 36 ± 62 x 106 SFC among TST-negative donors (p = 0.007). The response to GroEL2 (463-477) was only observed in the TST-positive group. This combination of novel MTB CD4 T-cell epitopes should be tested in a larger cohort of individuals with latent tuberculosis (TB) to evaluate its potential to diagnose latent TB and it may be included in ELISPOT-based IFN-γ assays to identify individuals with this condition.

Galveston Orientation Amnesia Test (GOAT)

O trauma crânio-encefálico contuso (TCEC) é freqüentemente seguido pela amnésia pós-traumática (APT), caracterizada como um estado transitório de confusão e desorientação. Sua duração tem sido utilizada para quantificar a gravidade do TCEC e prever distúrbios nas funções cognitivas, assim como para antever as alterações na capacidade funcional das vítimas pós-trauma. O Galveston Orientation Amnesia Test (GOAT) é o primeiro instrumento sistematizado criado e o mais amplamente utilizado para avaliar a APT. Este artigo apresenta esse instrumento, as bases conceituais para seu desenvolvimento e a adaptação e validação do GOAT para cultura brasileira. Além disso, descreve sua aplicação e comenta as restrições do seu uso. Resultados de pesquisas realizadas em nosso meio contribuíram para as evidências sobre a validade do GOAT. Também apontaram os indicadores do momento pós-trauma em que o GOAT deve ser aplicado e destacaram as dificuldades no uso desse instrumento.

Evaluation of neuromotor development by means of the Harris Infant Neuromotor Test

Objective: To investigate the neuromotor development of at-risk children between three and 12 months of life, administering the Brazilian version of the Harris Infant Neuromotor Test (HINT).Method: A longitudinal study, with 78 children and 76 parents/guardians discharged from a neonatal intensive care unit in Fortaleza-CE/Brazil. Two instruments were administered: HINT and a socioeconomic questionnaire, between July/2009 to August/2010. Data from 55 preterm and 23 term children were analyzed. Results: The final mean scores ranged from 14.6 to 25.2 and from 11.2 to 24.7, for preterm and term, respectively, showing that 91% of children demonstrated good neuromotor performance; seven premature infants showed alterations which led to the referral of three children to a specialized clinic for examination and diagnostics.Conclusion: The test allowed nurses to assess infant development, identify deviations early, and plan interventions.

Use of alcohol in the elderly: transcultural validation of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G)

Objective: To evaluate the internal consistency of the version of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G) instrument, translated and adapted for Brazil. Method: This was a descriptive, cross-sectional study. Data were collected through a demographic questionnaire, the ICD-10 and the MAST-G, following the steps of translation and cultural adaptation. One hundred eleven elderly in the city of São Carlos, SP, Brazil were interviewed. Results: The mean age of those interviewed was 70 years, with 45% men and 55% women, with the mean education of three years; 92% resided with family; 48% of the subjects consumed alcoholic beverages. The MAST-G presented a good level of reliability, with Cronbach’s α = 0.7873, and good levels of sensitivity and specificity with a cutoff score of five positive responses. Conclusion: The Brazilian version of the MAST-G presented internal consistency values similar to the original English version,showing it to be adequate for use in the national context.





Improvement of a test-chamber for behavioral studies on adult females of Aedes aegypti (Linnaeus) (Diptera, Culicidae)

A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae)

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.

Bioactivity of Indonesian mahogany, Toona sureni (Blume) (Meliaceae), against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae)

Bioactivity of Indonesian mahogany, Toona sureni (Blume) (Meliaceae), against the red flour beetle, Tribolium castaneum (Coleoptera, Tenebrionidae). The insecticidal activity of Toona sureni (Blume) Merr. was evaluated considering repellency, mortality and progeny production of F1 adults of Tribolium castaneum (Herbst, 1797) (Coleoptera, Tenebrionidae). Dried extract of seeds of T. sureni was dissolved in acetone to prepare solution of various concentrations (0.5, 1.0, 2.5 and 5.0%). To test for repellency, the insects were exposed to treated filter paper. Mortality of larvae, pupae and adults was evaluated by the treatment of spraying the insects with different concentrations of T. sureni extract. Residual effect of the extract was also evaluated considering the production of progeny of F1 adults. The highest repellency (93.30%) of T. castaneum occurred at the highest concentration (5.0% suspension of T. sureni); while the lowest (0.0%) repellency occurred at 0.5% suspension after 1 day of treatment. The highest mortality against adults (86.71%), larvae (88.32%) and pupae (85%) occurred at 5% suspension at 8 days after application. There was a negative correlation between the concentrations of T. sureni and the production of F1 adult's progeny of T. castaneum. The highest number of progeny (147) of T. castaneum occurred in the control at 7 days after treatment; and the lowest number of progeny (43) occurred at 5.0% concentration in 1 day after treatment. The results show that T. sureni is toxic to T. castaneum and has the potential to control all stages of this insect in stored wheat.

Qualidade do solo avaliada pelo "Soil Quality Kit Test" em dois experimentos de longa duração no Rio Grande do Sul

A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.

Extraction and concentration of biogenic calcium oxalate from plant leaves

The objective of this study was to extract and concentrate calcium oxalate (CaOx) crystals from plant leaves that form the above mentioned crystals. The chemical and physical studies of CaOx from plant to be performed depend on an adequate amount of the crystals. The plant used in this study was croton (Codiaeum variegatum). The leaves were ground in a heavy duty blender and sieved through a 0.20 mm sieve. The suspension obtained was suspended in distilled water. The crystals were concentrated at the bottom of a test tube. The supernatant must be washed until it is free of plant pigments and other organic substances. Biogenic CaOx crystals have well-defined and sharp peaks, indicating very high crystallinity. Moreover, the CaOx crystals were not damaged during the extraction procedure, as can be seen on the scanning electron microscope images. The porposed method can be considered efficient to extract and concentrate biogenic calcium oxalate.

Cobalt and molybdenum concentrated suspension for soybean seed treatment

The concentrated suspension (CS), the basis of Mo trioxide, allows high Mo concentrations and is therefore a technical advance for seed treatment, since it allows the recommendation of the Mo at lower dosage than with the liquid solution formulations (LS). The purpose of this research was to evaluate the efficiency and doses of fertilizer with Mo and Co in concentrated suspension in comparison with liquid solution as well as fertilizers associated with phytohormones, applied in seed treatments, and their effect on soybean yield. Two experiments were carried out in the growing seasons of 2004/2005 and 2005/2006 at the Universidade Federal de Uberlandia (UFU).The first was conducted in an experimental area on the Fazenda Capim Branco, with six treatments and four replications: (1) Mo and Co (CS) - 22 g ha-1 + 1.08 g ha-1; (2) Mo and Co (CS) - 22 g ha-1 + + 1.08 g ha-1 + phytohormone -200 mL ha-1; 3) Mo and Co (LS), 20.7 g ha-1 + 4.13 g ha-1; 4) Mo and Co (LS), 20.7 g ha-1 + 4.13 g ha-1 + phytohormone -200 mL ha-1; (5) + control phytohormone-200 mL ha-1; and (6) control (free of Mo and Co in the seed treatment). The phytohormone consisted of: auxin (11 mg L-1) and cytokynin (0.031 mg L-1). The soybean cultivar Monsoy 8004 was used and a fertilization of 400 kg ha-1 of 02-20-20 NPK fertilizer was applied at sowing. Based on the results of the first experiment, the second was conducted on the Fazenda Floresta do Lobo, in Uberlândia, MG, evaluated in a randomized block design with nine treatments and four replications. The treatments consisted of Mo and Co (g ha-1) doses applied to soybean seeds, as CS formulation (15, 25, 35, 45, 60 and 0.74; 1.23; 1.72; 2.21; 2.95) and LS- (15; 20; 25 and 3.18; 4.25; 5.31), respectively, and the control (free of Mo and Co in the seed treatment). The variety Monarch was used, fertilized with 300 kg ha-1 of NPK fertilizer (03-32-06) at sowing; and 78 kg ha-1 (K2O) in topdressing 30 days after soybean emergence. The Mo and Co doses in the seed treatment with LS and CS resulted in higher soybean yields than in the control, from 20 g ha-1 Mo and 4.25 g ha-1 Co in liquid solution and 35 g ha-1Mo and 1.72 g ha-1 Co in the concentrated suspension.

Pedotransfer functions to estimate proctor test parameters under different tillage systems

The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.

Portable penetrometer for agricultural soil: sensitivity test to identify critical compaction depth

To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.