189 resultados para Intravenous immune globulin
Resumo:
Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.
Resumo:
This study was designed to compare the variability of the onset and offset of the effect of two neuromuscular blocking drugs with different elimination pathways in adult and elderly patients during total intravenous anesthesia (TIVA). After Ethics Committee approval and patients’ informed consent, the drugs were compared in 40 adult and 40 elderly patients scheduled for elective surgery under TIVA with tracheal intubation who were randomized to receive a single bolus dose of 0.15 mg/kg cisatracurium or 0.9 mg/kg rocuronium. The time of onset of maximum depression, duration of action, and recovery index time were measured and recorded for each patient and variability is reported as means ± standard deviation. Time of onset was significantly shorter for rocuronium than cisatracurium for the adult and elderly groups (P = 0.000), but the variability of cisatracurium was significantly greater compared with rocuronium for the same age groups (93.25 vs 37.01 s in the adult group and 64.56 vs 33.75 s in the elderly group; P = 0.000). The duration of the effect in the elderly group receiving rocuronium was significantly longer than in the elderly group receiving cisatracurium, and the variability of the duration was significantly greater in the rocuronium group than in the cisatracurium group. Mean time of recovery was significantly longer for the elderly group receiving rocuronium than for the elderly group receiving cisatracurium (P = 0.022), and variability was also greater (P = 0.002). Both drugs favored good intubating conditions. In conclusion, cisatracurium showed less variability in these parameters than rocuronium, especially in the elderly, a fact that may be of particular clinical interest.
Resumo:
Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.
Resumo:
Cardiopulmonary bypass (CPB) with extracorporeal circulation produces changes in the immune system accompanied by an increase in proinflammatory cytokines and a decrease in anti-inflammatory cytokines. We hypothesize that dexmedetomidine (DEX) as an anesthetic adjuvant modulates the inflammatory response after coronary artery bypass graft surgery with mini-CPB. In a prospective, randomized, blind study, 12 patients (4 females and 8 males, age range 42-72) were assigned to DEX group and compared with a conventional total intravenous anesthesia (TIVA) group of 11 patients (4 females and 7 males). The endpoints used to assess inflammatory and biochemical responses to mini-CPB were plasma interleukin (IL)-1, IL-6, IL-10, interferon (INF)-γ, tumor necrosis factor (TNF)-α, C-reactive protein, creatine phosphokinase, creatine phosphokinase-MB, cardiac troponin I, cortisol, and glucose levels. These variables were determined before anesthesia, 90 min after beginning CPB, 5 h after beginning CPB, and 24 h after the end of surgery. Endpoints of oxidative stress, including thiobarbituric acid reactive species and delta-aminolevulinate dehydratase activity in erythrocytes were also determined. DEX+TIVA use was associated with a significant reduction in IL-1, IL-6, TNF-α, and INF-γ (P<0.0001) levels compared with TIVA (two-way ANOVA). In contrast, the surgery-induced increase in thiobarbituric acid reactive species was higher in the DEX+TIVA group than in the TIVA group (P<0.01; two-way ANOVA). Delta-aminolevulinate dehydratase activity was decreased after CPB (P<0.001), but there was no difference between the two groups. DEX as an adjuvant in anesthesia reduced circulating IL-1, IL-6, TNF-α, and INF-γ levels after mini-CPB. These findings indicate an interesting anti-inflammatory effect of DEX, which should be studied in different types of surgical interventions.
Resumo:
Protein fractions were isolated from lentil cotyledons and tannins were isolated and purified from lentil seed coats. The globulin fraction corresponded to 42.7% of the total lentil flour nitrogen, representing the major protein fraction. Acetone:water (7:3) was the best extractant for seed coat tannins compared to methanol or methanol-HCl 1%. Native and heated (99oC/15 min.) isolated lentil globulin and casein were hydrolyzed with trypsin and pepsin in the absence of tannins and at 1:40, 1:20, 1:10, 1:5 and 1:2.5 tannin-to-protein ratios. The tryptic and peptic hydrolysis of the unheated proteins were reduced with increasing tannin-to-protein ratios. Unheated casein showed to be more susceptible to trypsin than globulin and the opposite effect was observed with pepsin. Heating followed by tannin interaction and hydrolysis had a more pronounced effect on tryptic than peptic digestion for both proteins.
Resumo:
Defatted Brazil nut kernel flour, a rich source of high quality proteins, is presently being utilized in the formulation of animal feeds. One of the possible ways to improve its utilization for human consumption is through improvement in its functional properties. In the present study, changes in some of the functional properties of Brazil nut kernel globulin were evaluated after acetylation at 58.6, 66.2 and 75.3% levels. The solubility of acetylated globulin was improved above pH 6.0 but was reduced in the pH range of 3.0-4.0. Water and oil absorption capacity, as well as the viscosity increased with increase in the level of acetylation. Level of modification also influenced the emulsifying capacity: decreased at pH 3.0, but increased at pH 7.0 and 9.0. Highest emulsion activity (approximately 62.2%) was observed at pH 3.0 followed by pH 9.0 and pH 7.0 and least (about 11.8%) at pH 5.0. Emulsion stability also followed similar behavior as that of emulsion activity.
Resumo:
Chickpea seed germination was carried out over a period of 6 days. Little variation in the nitrogen and total globulin content was observed. The major globulin (11 S type) showed higher variation after the 4th day of germination. The elution behaviour and distribution of the isolated major globulin fraction on Sepharose CL-6B chromatography showed little modification at the end of germination. On SDS-PAGE the peak eluted from Sepharose CL-6B showed changes in protein bands between 20 and 30 kDa and above 60 kDa, indicating protein degradation during the period. Proteolytic activity was detected in the albumin fraction of the seeds, which increased up to the fourth and then decreased up to the sixth day, when isolated chickpea total globulin and casein were used as substrates. Chickpea flour, isolated albumin and total globulin fractions did not show an increase for in vitro digestibility; however, the isolated major globulin was more susceptible to hydrolysis after germination.