195 resultados para Immune complexes
Resumo:
Hantavirus cardiopulmonary syndrome (HCPS) has been recognized as an important public heath problem. Five hantaviruses associated with HCPS are currently known in Brazil: Juquitiba, Araraquara, Laguna Negra-like, Castelo dos Sonhos, and Anajatuba viruses. The laboratory diagnosis of HCPS is routinely carried out by the detection of anti-hantavirus IgM and/or IgG antibodies. The present study describes the expression of the N protein of a hantavirus detected in the blood sample of an HCPS patient. The entire S segment of the virus was amplified and found to be 1858 nucleotides long, with an open reading frame of 1287 nucleotides that encodes a protein of 429 amino acids. The nucleotide sequence described here showed a high identity with the N protein gene of Araraquara virus. The entire N protein was expressed using the vector pET200D and the Escherichia coli BL21 strain. The expression of the recombinant protein was confirmed by the detection of a 52-kDa protein by Western blot using a pool of human sera obtained from HCPS patients, and by specific IgG detection in five serum samples of HCPS patients tested by ELISA. These results suggest that the recombinant N protein could be used as an antigen for the serological screening of hantavirus infection.
Resumo:
The effect of N-acetylcysteine, a thiolic antioxidant, on attenuation of phosphamidon-induced oxidative stress and immune dysfunction was evaluated in adult male Wistar rats weighing 200-250 g. Rats were divided into four groups, 8 animals/group, and treated with phosphamidon, N-acetylcysteine or the combination of both for 28 days. Oral administration of phosphamidon (1.74 mg/kg), an organophosphate insecticide, increased serum malondialdehyde (3.83 ± 0.18 vs 2.91 ± 0.24 nmol/mL; P < 0.05) and decreased erythrocyte superoxide dismutase (567.8 ± 24.36 vs 749.16 ± 102.61 U/gHb; P < 0.05), catalase activity (1.86 ± 0.18 vs 2.43 ± 0.08 U/gHb; P < 0.05) and whole blood glutathione levels (1.25 ± 0.21 vs 2.28 ± 0.08 mg/gHb; P < 0.05) showing phosphamidon-induced oxidative stress. Phosphamidon exposure markedly suppressed humoral immune response as assessed by antibody titer to ovalbumin (4.71 ± 0.51 vs 8.00 ± 0.12 -log2; P < 0.05), and cell-mediated immune response as assessed by leukocyte migration inhibition (25.24 ± 1.04 vs 70.8 ± 1.09%; P < 0.05) and macrophage migration inhibition (20.38 ± 0.99 vs 67.16 ± 5.30%; P < 0.05) response. Phosphamidon exposure decreased IFN-у levels (40.7 ± 3.21 vs 55.84 ± 3.02 pg/mL; P < 0.05) suggesting a profound effect of phosphamidon on cell-mediated immune response. A phosphamidon-induced increase in TNF-α level (64.19 ± 6.0 vs 23.16 ± 4.0 pg/mL; P < 0.05) suggests a contributory role of immunocytes in oxidative stress. Co-administration of N-acetylcysteine (3.5 mmol/kg, orally) with phosphamidon attenuated the adverse effects of phosphamidon. These findings suggest that oral N-acetylcysteine treatment exerts protective effect and attenuates free radical injury and immune dysfunction caused by subchronic phosphamidon exposure.
Resumo:
Blomia tropicalis, Dermatophagoides pteronyssinus and D. farinae are prevalent house dust mites. Concanavalin A-binding components derived from B. tropicalis (Bt-ConA extract) are highly immunogenic in allergic diseases. The aim of the present study was to evaluate the humoral and cellular immune responses to B. tropicalis in mite-sensitized patients. A total of 137 patients with allergic rhinitis with/without asthma and 109 non-atopic subjects were selected and analyzed by the skin prick test, and for total serum IgE and specific IgE levels to both Bt-total and Bt-ConA extracts, their proliferative response and cytokine (IFN-γ and IL-5) production by peripheral blood mononuclear cells (PBMC) stimulated with both extracts. Skin prick test showed that 70% of the patients were sensitized to Bt (Bt+) and similar levels of specific IgE to Bt-total and Bt-ConA extracts were demonstrable in Bt+ patients. Significant PBMC proliferation was observed in response to Bt-total extract in Bt+, but not in Bt- patients and non-atopic subjects (P < 0.001). Bt-ConA extract induced increased proliferative responses in all patient groups compared to medium alone (P < 0.05), but these responses were significantly decreased in the presence of the mannopyranoside ConA inhibitor (P < 0.05). Significant IFN-γ production was observed after Bt-ConA stimulation of Bt+ patients (P < 0.05), while Bt-total extract had no effect. IL-5 production was consistently detected in Bt+ patients after allergen-specific stimulation or with no stimulus, indicating that PBMC from allergic patients are prone to produce Th2 profile cytokines, spontaneously or inductively by allergen restimulation. These data showed that ConA-binding components isolated from B. tropicalis may contain relevant antigens that are involved in both humoral and cellular immune responses. However, without an additional purification procedure to eliminate the residual contamination with ConA, its use in immunotherapeutic procedures cannot be recommended.
Resumo:
Nitric oxide (NO) donors produce NO-related activity when applied to biological systems. Among its diverse functions, NO has been implicated in vascular smooth muscle relaxation. Despite the great importance of NO in biological systems, its pharmacological and physiological studies have been limited due to its high reactivity and short half-life. In this review we will focus on our recent investigations of nitrosyl ruthenium complexes as NO-delivery agents and their effects on vascular smooth muscle cell relaxation. The high affinity of ruthenium for NO is a marked feature of its chemistry. The main signaling pathway responsible for the vascular relaxation induced by NO involves the activation of soluble guanylyl-cyclase, with subsequent accumulation of cGMP and activation of cGMP-dependent protein kinase. This in turn can activate several proteins such as K+ channels as well as induce vasodilatation by a decrease in cytosolic Ca2+. Oxidative stress and associated oxidative damage are mediators of vascular damage in several cardiovascular diseases, including hypertension. The increased production of the superoxide anion (O2-) by the vascular wall has been observed in different animal models of hypertension. Vascular relaxation to the endogenous NO-related response or to NO released from NO deliverers is impaired in vessels from renal hypertensive (2K-1C) rats. A growing amount of evidence supports the possibility that increased NO inactivation by excess O2- may account for the decreased NO bioavailability and vascular dysfunction in hypertension.
Resumo:
Genes encoding lipoproteins LipL32, LipL41 and the outer-membrane protein OmpL1 of leptospira were recombined and cloned into a pVAX1 plasmid. BALB/c mice were immunized with LipL32 and recombined LipL32-41-OmpL1 using DNA-DNA, DNA-protein and protein-protein strategies, respectively. Prime immunization was on day 1, boost immunizations were on day 11 and day 21. Sera were collected from each mouse on day 35 for antibody, cytokine detection and microscopic agglutination test while spleen cells were collected for splenocyte proliferation assay. All experimental groups (N = 10 mice per group) showed statistically significant increases in antigen-specific antibodies, in cytokines IL-4 and IL-10, as well as in the microscopic agglutination test and splenocyte proliferation compared with the pVAX1 control group. The groups receiving the recombined LipL32-41-OmpL1 vaccine induced anti-LipL41 and anti-OmpL1 antibodies and yielded better splenocyte proliferation values than the groups receiving LipL32. DNA prime and protein boost immune strategies stimulated more antibodies than a DNA-DNA immune strategy and yielded greater cytokine and splenocyte proliferation than a protein-protein immune strategy. It is clear from these results that recombination of protective antigen genes lipL32, lipL41, and ompL1 and a DNA-protein immune strategy resulted in better immune responses against leptospira than single-component, LipL32, or single DNA or protein immunization.
Resumo:
Sepsis is a systemic inflammatory response that can lead to tissue damage and death. In order to increase our understanding of sepsis, experimental models are needed that produce relevant immune and inflammatory responses during a septic event. We describe a lipopolysaccharide tolerance mouse model to characterize the cellular and molecular alterations of immune cells during sepsis. The model presents a typical lipopolysaccharide tolerance pattern in which tolerance is related to decreased production and secretion of cytokines after a subsequent exposure to a lethal dose of lipopolysaccharide. The initial lipopolysaccharide exposure also altered the expression patterns of cytokines and was followed by an 8- and a 1.5-fold increase in the T helper 1 and 2 cell subpopulations. Behavioral data indicate a decrease in spontaneous activity and an increase in body temperature following exposure to lipopolysaccharide. In contrast, tolerant animals maintained production of reactive oxygen species and nitric oxide when terminally challenged by cecal ligation and puncture (CLP). Survival study after CLP showed protection in tolerant compared to naive animals. Spleen mass increased in tolerant animals followed by increases of B lymphocytes and subpopulation Th1 cells. An increase in the number of stem cells was found in spleen and bone marrow. We also showed that administration of spleen or bone marrow cells from tolerant to naive animals transfers the acquired resistance status. In conclusion, lipopolysaccharide tolerance is a natural reprogramming of the immune system that increases the number of immune cells, particularly T helper 1 cells, and does not reduce oxidative stress.
Resumo:
Rubinstein-Taybi syndrome (RTS) is a rare developmental disorder characterized by craniofacial dysmorphisms, broad thumbs and toes, mental and growth deficiency, and recurrent respiratory infections. RTS has been associated with CREBBP gene mutations, but EP300 gene mutations have recently been reported in 6 individuals. In the present study, the humoral immune response in 16 RTS patients with recurrent respiratory infections of possible bacterial etiology was evaluated. No significant differences between patients and 16 healthy controls were detected to explain the high susceptibility to respiratory infections: normal or elevated serum immunoglobulin levels, normal salivary IgA levels, and a good antibody response to both polysaccharide and protein antigens were observed. However, most patients presented high serum IgM levels, a high number of total B cell and B subsets, and also high percentiles of apoptosis, suggesting that they could present B dysregulation. The CREBBP/p300 family gene is extremely important for B-cell regulation, and RTS may represent an interesting human model for studying the molecular mechanisms involved in B-cell development.
Resumo:
Infection with the protozoan parasite Trypanosoma cruzi leads to Chagas disease, which affects millions of people in Latin America. Infection with T. cruzi cannot be eliminated by the immune system. A better understanding of immune evasion mechanisms is required in order to develop more effective vaccines. During the acute phase, parasites replicate extensively and release immunomodulatory molecules that delay parasite-specific responses mediated by T cells. This immune evasion allows the parasite to spread in the host. In the chronic phase, parasite evasion relies on its replication strategy of hijacking the TGF-β signaling pathway involved in inflammation and tissue regeneration. In this article, the mechanisms of immune evasion described for T. cruzi are reviewed.
Resumo:
In a prospective case-control study, we compared the amniotic fluid amino acid levels in non-immune hydrops fetalis (NIHF) and normal fetuses. Eighty fetuses underwent amniocentesis for different reasons at the prenatal diagnosis unit of the Department of Obstetrics and Gynecology, Faculty of Medicine, Dicle University. Forty of these fetuses were diagnosed with NIHF. The study included 40 women each in the NIHF (mean age: 27.69 ± 4.56 years) and control (27.52 ± 5.49 years) groups, who had abnormal double- or triple-screening test values with normal fetuses with gestational ages of 23.26 ± 1.98 and 23.68 ± 1.49 weeks at the time of sample collection, respectively. Amniotic fluid amino acid concentrations (intra-assay variation: 2.26-7.85%; interassay variation: 3.45-8.22%) were measured using EZ:faast kits (EZ:faast GC/FID free (physiological) amino acid kit; Phenomenex, USA) by gas chromatography. The standard for quantitation was a mixture of free amino acids from Phenomenex. The levels of 21 amino acids were measured. The mean phosphoserine and serine levels were significantly lower in the NIHF group, while the taurine, α-aminoadipic acid (aaa), glycine, cysteine, NH4, and arginine (Arg) levels were significantly higher compared to control. Significant risk variables for the NIHF group and odds coefficients were obtained using a binary logistic regression method. The respective odds ratios and 95% confidence intervals for the risk variables phosphoserine, taurine, aaa, Arg, and NH4 were 3.31 (1.84-5.97), 2.45 (1.56-3.86), 1.78 (1.18-2.68), 2.18 (1.56-3.04), and 2.41 (1.66-3.49), respectively. The significant difference between NIHF and control fetuses suggests that the amniotic fluid levels of some amino acids may be useful for the diagnosis of NIHF.
Resumo:
The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.
Resumo:
Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.
Resumo:
Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.
Resumo:
Levamisole has been increasingly used as an adulterant of cocaine in recent years, emerging as a public health challenge worldwide. Levamisole-associated toxicity manifests clinically as a systemic vasculitis, consisting of cutaneous, hematological, and renal lesions, among others. Purpura retiform, cutaneous necrosis, intravascular thrombosis, neutropenia, and less commonly crescentic nephritis have been described in association with anti-neutrophil cytoplasmic antibodies (ANCAs) and other autoantibodies. Here we report the case of a 49-year-old male who was a chronic cocaine user, and who presented spontaneous weight loss, arthralgia, and 3 weeks before admission purpuric skin lesions in the earlobes and in the anterior thighs. His laboratory tests on admission showed serum creatinine of 4.56 mg/dL, white blood count 3,800/μL, hemoglobin 7.3 g/dL, urinalysis with 51 white blood cells/μL and 960 red blood cells/μL, and urine protein-to-creatinine ratio 1.20. Serum ANCA testing was positive (>1:320), as well as serum anti-myeloperoxidase and anti-proteinase 3 antibodies. Urine toxicology screen was positive for cocaine and levamisole, with 62.8% of cocaine, 32.2% of levamisole, and 5% of an unidentified substance. Skin and renal biopsies were diagnostic for leukocytoclastic vasculitis and pauci-immune crescentic glomerulonephritis, respectively. The patient showed a good clinical response to cocaine abstinence, and use of corticosteroids and intravenous cyclophosphamide. Last serum creatinine was 1.97 mg/dL, white blood cell count 7,420/μL, and hemoglobin level 10.8 g/dL. In levamisole-induced systemic vasculitis, the early institution of cocaine abstinence, concomitant with the use of immunosuppressive drugs in severe cases, may prevent permanent end organ damage and associate with better clinical outcomes.