Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

Caracterização do dna ribossômico do isolado de Scleroderma UFSMSc1 de Eucalyptus grandis W. Hill ex-maiden

O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Characterization of mandarin citrus germplasm from Southern Brazil by morphological and molecular analyses

The objective of this work was to characterize mandarin (Citrus spp.) germplasm from Southern Brazil by morphological and molecular analyses. Thirty seven cultivars from 34 distinct mandarin varieties were evaluated by morphological and agronomic traits of leaves, flowers and fruits, and by microsatellite markers. The morphological and agronomic characteristics suggested that almost all varieties can be produced for commercial use, and some, as the Satsuma variety, are recommended for breeding programs. Pooled DNA samples from 1-5 plants belonging to each cultivar were tested. Eight of the nine primers detected polymorphisms. Specific markers were found for some accessions. The dendrogram constructed with the morphological results divided the 37 cultivars into four groups, while that obtained with the microsatellites clustered 35 of the 37 cultivars into three groups only. Generally, intervarietal differences are not high, and this lack of agreement in the two multifactorial analyses indicates that diverse evolutionary factors are acting at these two levels of investigation.

Validation of microsatellite markers for assisted selection of soybean resistance to cyst nematode races 3 and 14

The objective of this work was to validate microsatellite markers associated with resistance to soybean cyst nematode (Heterodera glycines Ichinohe) races 3 and 14, in soybean (Glycine max L.) genotypes, for use in marker-assisted selection (MAS) programs. Microsatellites of soybean linkage groups A2, D2 and G were tested in two populations, and their selection efficiencies were determined. The populations were 65 F2:3 families from Msoy8001 (resistant) x Conquista (susceptible) cross, and 66 F2:3 families of S5995 (resistant) x Renascença (susceptible) cross, evaluated for resistance to races 3 and 14, respectively. Families with female index up to 30% were considered moderately resistant. Markers of A2 and G linkage groups were associated with resistance to race 3. Markers Satt309 and GMENOD2B explained the greatest proportion of phenotypic variance in the different groups. The combinations Satt309+GMENOD2B and Satt309+Satt187 presented 100% selection efficiency. Resistance to race 14 was associated with markers of G linkage group, and selection efficiency in the Satt309+Satt356 combination was 100%. The selection differential obtained by phenotypic and marker assisted selection showed that both can result in similar gains.

Mitochondrial DNA of Nellore and European x Nellore crossing cattle of high performance

The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.

New microsatellite markers developed from an enriched microsatellite common bean library

The objective of this work was to develop new microsatellite markers in common bean. Ninety nine new microsatelitte loci were developed from a microsatellite enriched library for (CT)8 and (GT)8 motifs, from CAL-143 line. The majority of microsatellite sequences (51%) was related to cellular metabolism. The remaining sequences were associated to transcription functions. Only 17.2% of the sequences presented some level of similarity with other plant species genes.

DNA barcodes for soil animal taxonomy

The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.

Potato cultivar identification using molecular markers

The objective of this work was to evaluate a set of microsatellite markers for varietal identification and characterization of the most widespread potato cultivars in Brazil. The DNA from 14 potato cultivars was genotyped using microsatellite markers and the alleles were scored in silver-stained polyacrylamide gel. Twenty-four microsatellite markers were evaluated, and only one locus was monomorphic. Based on band patterns, a set of two microsatellites that were able to identify and differentiate all examined cultivars was obtained.