174 resultados para accelerated permeability test
Resumo:
Abstract OBJECTIVE Determining which is the most effective solution (heparin flush compared to 0.9% saline flush) for reducing the risk of occlusions in central venous catheters (CVC) in adults. METHOD The systematic review followed the principles proposed by the Cochrane Handbook; critical analysis, extraction and synthesis of data were performed by two independent researchers; statistical analysis was performed using the RevMan program 5.2.8. RESULTS Eight randomized controlled trials and one cohort study were included and the results of the meta-analysis showed no difference (RR=0.68, 95% CI=0.41-1.10; p=0.12). Analysis by subgroups showed that there was no difference in fully deployed CVC (RR=1.09, CI 95%=0.53-2.22;p=0.82); Multi-Lumen CVC showed beneficial effects in the heparin group (RR=0.53, CI 95%=0.29-0.95; p=0.03); in Double-Lumen CVC for hemodialysis (RR=1.18, CI 95%=0.08-17.82;p=0.90) and Peripherally inserted CVC (RR=0.14, CI 95%=0.01-2.60; p=0.19) also showed no difference. CONCLUSION Saline solution is sufficient for maintaining patency of the central venous catheter, preventing the risks associated with heparin administration.
Resumo:
A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.
Resumo:
An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.
Resumo:
A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.
Resumo:
The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.
Resumo:
To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objective of this work was to evaluate the effects of temperature (10, 20, 30, 20/10 and 30/10ºC) and period of storage on electrical conductivity (EC) in four seed lots of corn (Zea mays L.), as well as the mineral composition of the soaking solution. EC test determines indirectly the integrity of seed membrane systems, and is used for the assessment of seed vigor, because this test detects the seed deterioration process since its early phase. The research comprised determinations of water content, germination, accelerated aging (AA), cold (CT) and EC vigor tests, and determinations of Ca2+, Mg2+ and K+ release to the solution, after seed soaking of four corn seed lots. The evaluations were performed each four months during a period of 16 months. For statistical analysis, a completely randomized split plot design was used with eight replications. Except for seed lots stored at 10ºC, all vigor evaluations revealed a decline in vigor, but AA and CT showed more sensitiveness to declines of seed physiological quality than EC. Potassium was the main leached ion regardless of the storage temperature.
Resumo:
The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.