An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae)

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.

Exon-primed intron-crossing (EPIC) markers as a tool for ant phylogeography

Exon-primed intron-crossing (EPIC) markers as a tool for ant phylogeography. Due to their local abundance, diversity of adaptations and worldwide distribution, ants are a classic example of adaptive radiation. Despite this evolutionary and ecological importance, phylogeographical studies on ants have relied largely on mitochondrial markers. In this study we design and test exon-primed intron-crossing (EPIC) markers, which can be widely used to uncover ant intraspecific variation. Candidate markers were obtained through screening the available ant genomes for unlinked conserved exonic regions interspersed with introns. A subset of 15 markers was tested in vitro and showed successful amplification in several phylogenetically distant ant species. These markers represent an important step forward in ant phylogeography and population genetics, allowing for more extensive characterization of variation in ant nuclear DNA without the need to develop species-specific markers.

Qualidade do solo avaliada pelo "Soil Quality Kit Test" em dois experimentos de longa duração no Rio Grande do Sul

A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.

Dielectric constant obtained from TDR and volumetric moisture of soils in southern Brazil

Soil moisture is the property which most greatly influences the soil dielectric constant, which is also influenced by soil mineralogy. The aim of this study was to determine mathematical models for soil moisture and the dielectric constant (Ka) for a Hapludalf, two clayey Hapludox and a very clayey Hapludox and test the reliability of universal models, such as those proposed by Topp and Ledieu and their co-workers in the 80's, and specific models to estimate soil moisture with a TDR. Soil samples were collected from the 0 to 0.30 m layer, sieved through a mesh of 0.002 m diameter and packed in PVC cylinders with a 0.1 m diameter and 0.3 m height. Seven samples of each soil class were saturated by capillarity and a probe composed of two rods was inserted in each one of them. Moisture readings began with the saturated soil and concluded when the soil was near permanent wilting point. In each step, the samples were weighed on a precision scale to calculate volumetric moisture. Linear and polynomial models were adjusted for each soil class and for all soils together between soil moisture and the dielectric constant. Accuracy of the models was evaluated by the coefficient of determination, the standard error of estimate and the 1:1 line. The models proposed by Topp and Ledieu and their co-workers were not adequate for estimating the moisture in the soil classes studied. The adjusted linear and polynomial models for the entire set of data of the four soil classes did not have sufficient accuracy for estimating soil moisture. The greater the soil clay and Fe oxide content, the greater the dielectric constant of the medium for a given volumetric moisture. The specific models, θ = 0.40283 - 0.04231 Ka + 0.00194 Ka² - 0.000022 Ka³ (Hapludox) θ = 0.01971 + 0.02902 Ka - 0.00086 Ka² + 0.000012 Ka³ (Hapludox -PF), θ = 0.01692 - 0.00507 Ka (Hapludalf) and θ = 0.08471 + 0.01145 Ka (Hapludox-CA), show greater accuracy and reliability for estimating soil moisture in the soil classes studied.

Pedotransfer functions to estimate proctor test parameters under different tillage systems

The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.

Portable penetrometer for agricultural soil: sensitivity test to identify critical compaction depth

To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.

Molecular Identification of Trichoderma spp. in Garlic and Onion Fields and In Vitro Antagonism Trials on Sclerotium cepivorum

ABSTRACT Trichoderma species are non-pathogenic microorganisms that protect against fungal diseases and contribute to increased crop yields. However, not all Trichoderma species have the same effects on crop or a pathogen, whereby the characterization and identification of strains at the species level is the first step in the use of a microorganism. The aim of this study was the identification – at species level – of five strains of Trichoderma isolated from soil samples obtained from garlic and onion fields located in Costa Rica, through the analysis of the ITS1, 5.8S, and ITS2 ribosomal RNA regions; as well as the determination of their individual antagonistic ability over S. cepivorum Berkeley. In order to distinguish the strains, the amplified products were analyzed using MEGA v6.0 software, calculating the genetic distances through the Tamura-Nei model and building the phylogenetic tree using the Maximum Likelihood method. We established that the evaluated strains belonged to the species T. harzianum and T. asperellum; however it was not possible to identify one of the analyzed strains based on the species criterion. To evaluate their antagonistic ability, the dual culture technique, Bell’s scale, and the percentage inhibition of radial growth (PIRG) were used, evidencing that one of the T. asperellum isolates presented the best yields under standard, solid fermentation conditions.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Conductivity test in seeds of different passion flower species

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.