179 resultados para Immune Defense


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mycobacterium tuberculosis kills more people than any other single pathogen, with an estimated one-third of the world's population being infected. Among those infected, only 10% will develop the disease. There are several demonstrations that susceptibility to tuberculosis is linked to host genetic factors in twins, family and associated-based case control studies. In the past years, there has been dramatic improvement in our understanding of the role of innate and adaptive immunity in the human host defense to tuberculosis. To date, attention has been paid to the role of genetic host and parasitic factors in tuberculosis pathogenesis mainly regarding innate and adaptive immune responses and their complex interactions. Many studies have focused on the candidate genes for tuberculosis susceptibility ranging from those expressed in several cells from the innate or adaptive immune system such as Toll-like receptors, cytokines (TNF-α, TGF-β, IFN-γ, IL-1b, IL-1RA, IL-12, IL-10), nitric oxide synthase and vitamin D, both nuclear receptors and their carrier, the vitamin D-binding protein (VDBP). The identification of possible genes that can promote resistance or susceptibility to tuberculosis could be the first step to understanding disease pathogenesis and can help to identify new tools for treatment and vaccine development. Thus, in this mini-review, we summarize the current state of investigation on some of the genetic determinants, such as the candidate polymorphisms of vitamin D, VDBP, Toll-like receptor, nitric oxide synthase 2 and interferon-γ genes, to generate resistance or susceptibility to M. tuberculosis infection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Genes encoding lipoproteins LipL32, LipL41 and the outer-membrane protein OmpL1 of leptospira were recombined and cloned into a pVAX1 plasmid. BALB/c mice were immunized with LipL32 and recombined LipL32-41-OmpL1 using DNA-DNA, DNA-protein and protein-protein strategies, respectively. Prime immunization was on day 1, boost immunizations were on day 11 and day 21. Sera were collected from each mouse on day 35 for antibody, cytokine detection and microscopic agglutination test while spleen cells were collected for splenocyte proliferation assay. All experimental groups (N = 10 mice per group) showed statistically significant increases in antigen-specific antibodies, in cytokines IL-4 and IL-10, as well as in the microscopic agglutination test and splenocyte proliferation compared with the pVAX1 control group. The groups receiving the recombined LipL32-41-OmpL1 vaccine induced anti-LipL41 and anti-OmpL1 antibodies and yielded better splenocyte proliferation values than the groups receiving LipL32. DNA prime and protein boost immune strategies stimulated more antibodies than a DNA-DNA immune strategy and yielded greater cytokine and splenocyte proliferation than a protein-protein immune strategy. It is clear from these results that recombination of protective antigen genes lipL32, lipL41, and ompL1 and a DNA-protein immune strategy resulted in better immune responses against leptospira than single-component, LipL32, or single DNA or protein immunization.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sepsis is a systemic inflammatory response that can lead to tissue damage and death. In order to increase our understanding of sepsis, experimental models are needed that produce relevant immune and inflammatory responses during a septic event. We describe a lipopolysaccharide tolerance mouse model to characterize the cellular and molecular alterations of immune cells during sepsis. The model presents a typical lipopolysaccharide tolerance pattern in which tolerance is related to decreased production and secretion of cytokines after a subsequent exposure to a lethal dose of lipopolysaccharide. The initial lipopolysaccharide exposure also altered the expression patterns of cytokines and was followed by an 8- and a 1.5-fold increase in the T helper 1 and 2 cell subpopulations. Behavioral data indicate a decrease in spontaneous activity and an increase in body temperature following exposure to lipopolysaccharide. In contrast, tolerant animals maintained production of reactive oxygen species and nitric oxide when terminally challenged by cecal ligation and puncture (CLP). Survival study after CLP showed protection in tolerant compared to naive animals. Spleen mass increased in tolerant animals followed by increases of B lymphocytes and subpopulation Th1 cells. An increase in the number of stem cells was found in spleen and bone marrow. We also showed that administration of spleen or bone marrow cells from tolerant to naive animals transfers the acquired resistance status. In conclusion, lipopolysaccharide tolerance is a natural reprogramming of the immune system that increases the number of immune cells, particularly T helper 1 cells, and does not reduce oxidative stress.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The phyllosphere, i.e., the aerial parts of the plant, provides one of the most important niches for microbial colonization. This niche supports the survival and, often, proliferation of microbes such as fungi and bacteria with diverse lifestyles including epiphytes, saprophytes, and pathogens. Although most microbes may complete the life cycle on the leaf surface, pathogens must enter the leaf and multiply aggressively in the leaf interior. Natural surface openings, such as stomata, are important entry sites for bacteria. Stomata are known for their vital role in water transpiration and gas exchange between the plant and the environment that is essential for plant growth. Recent studies have shown that stomata can also play an active role in limiting bacterial invasion of both human and plant pathogenic bacteria as part of the plant innate immune system. As counter-defense, plant pathogens such as Pseudomonas syringae pv tomato (Pst) DC3000 use the virulence factor coronatine to suppress stomate-based defense. A novel and crucial early battleground in host-pathogen interaction in the phyllosphere has been discovered with broad implications in the study of bacterial pathogenesis, host immunity, and molecular ecology of bacterial diseases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rubinstein-Taybi syndrome (RTS) is a rare developmental disorder characterized by craniofacial dysmorphisms, broad thumbs and toes, mental and growth deficiency, and recurrent respiratory infections. RTS has been associated with CREBBP gene mutations, but EP300 gene mutations have recently been reported in 6 individuals. In the present study, the humoral immune response in 16 RTS patients with recurrent respiratory infections of possible bacterial etiology was evaluated. No significant differences between patients and 16 healthy controls were detected to explain the high susceptibility to respiratory infections: normal or elevated serum immunoglobulin levels, normal salivary IgA levels, and a good antibody response to both polysaccharide and protein antigens were observed. However, most patients presented high serum IgM levels, a high number of total B cell and B subsets, and also high percentiles of apoptosis, suggesting that they could present B dysregulation. The CREBBP/p300 family gene is extremely important for B-cell regulation, and RTS may represent an interesting human model for studying the molecular mechanisms involved in B-cell development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infection with the protozoan parasite Trypanosoma cruzi leads to Chagas disease, which affects millions of people in Latin America. Infection with T. cruzi cannot be eliminated by the immune system. A better understanding of immune evasion mechanisms is required in order to develop more effective vaccines. During the acute phase, parasites replicate extensively and release immunomodulatory molecules that delay parasite-specific responses mediated by T cells. This immune evasion allows the parasite to spread in the host. In the chronic phase, parasite evasion relies on its replication strategy of hijacking the TGF-β signaling pathway involved in inflammation and tissue regeneration. In this article, the mechanisms of immune evasion described for T. cruzi are reviewed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In a prospective case-control study, we compared the amniotic fluid amino acid levels in non-immune hydrops fetalis (NIHF) and normal fetuses. Eighty fetuses underwent amniocentesis for different reasons at the prenatal diagnosis unit of the Department of Obstetrics and Gynecology, Faculty of Medicine, Dicle University. Forty of these fetuses were diagnosed with NIHF. The study included 40 women each in the NIHF (mean age: 27.69 ± 4.56 years) and control (27.52 ± 5.49 years) groups, who had abnormal double- or triple-screening test values with normal fetuses with gestational ages of 23.26 ± 1.98 and 23.68 ± 1.49 weeks at the time of sample collection, respectively. Amniotic fluid amino acid concentrations (intra-assay variation: 2.26-7.85%; interassay variation: 3.45-8.22%) were measured using EZ:faast kits (EZ:faast GC/FID free (physiological) amino acid kit; Phenomenex, USA) by gas chromatography. The standard for quantitation was a mixture of free amino acids from Phenomenex. The levels of 21 amino acids were measured. The mean phosphoserine and serine levels were significantly lower in the NIHF group, while the taurine, α-aminoadipic acid (aaa), glycine, cysteine, NH4, and arginine (Arg) levels were significantly higher compared to control. Significant risk variables for the NIHF group and odds coefficients were obtained using a binary logistic regression method. The respective odds ratios and 95% confidence intervals for the risk variables phosphoserine, taurine, aaa, Arg, and NH4 were 3.31 (1.84-5.97), 2.45 (1.56-3.86), 1.78 (1.18-2.68), 2.18 (1.56-3.04), and 2.41 (1.66-3.49), respectively. The significant difference between NIHF and control fetuses suggests that the amniotic fluid levels of some amino acids may be useful for the diagnosis of NIHF.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recognition of pathogens is performed by specific receptors in cells of the innate immune system, which may undergo modulation during the continuum of clinical manifestations of sepsis. Monocytes and neutrophils play a key role in host defense by sensing and destroying microorganisms. This study aimed to evaluate the expression of CD14 receptors on monocytes; CD66b and CXCR2 receptors on neutrophils; and TLR2, TLR4, TLR5, TLR9, and CD11b receptors on both cell types of septic patients. Seventy-seven septic patients (SP) and 40 healthy volunteers (HV) were included in the study, and blood samples were collected on day zero (D0) and after 7 days of therapy (D7). Evaluation of the cellular receptors was carried out by flow cytometry. Expression of CD14 on monocytes and of CD11b and CXCR2 on neutrophils from SP was lower than that from HV. Conversely, expression of TLR5 on monocytes and neutrophils was higher in SP compared with HV. Expression of TLR2 on the surface of neutrophils and that of TLR5 on monocytes and neutrophils of SP was lower at D7 than at D0. In addition, SP who survived showed reduced expression of TLR2 and TLR4 on the surface of neutrophils at D7 compared to D0. Expression of CXCR2 for surviving patients was higher at follow-up compared to baseline. We conclude that expression of recognition and cell signaling receptors is differentially regulated between SP and HV depending on the receptor being evaluated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Levamisole has been increasingly used as an adulterant of cocaine in recent years, emerging as a public health challenge worldwide. Levamisole-associated toxicity manifests clinically as a systemic vasculitis, consisting of cutaneous, hematological, and renal lesions, among others. Purpura retiform, cutaneous necrosis, intravascular thrombosis, neutropenia, and less commonly crescentic nephritis have been described in association with anti-neutrophil cytoplasmic antibodies (ANCAs) and other autoantibodies. Here we report the case of a 49-year-old male who was a chronic cocaine user, and who presented spontaneous weight loss, arthralgia, and 3 weeks before admission purpuric skin lesions in the earlobes and in the anterior thighs. His laboratory tests on admission showed serum creatinine of 4.56 mg/dL, white blood count 3,800/μL, hemoglobin 7.3 g/dL, urinalysis with 51 white blood cells/μL and 960 red blood cells/μL, and urine protein-to-creatinine ratio 1.20. Serum ANCA testing was positive (>1:320), as well as serum anti-myeloperoxidase and anti-proteinase 3 antibodies. Urine toxicology screen was positive for cocaine and levamisole, with 62.8% of cocaine, 32.2% of levamisole, and 5% of an unidentified substance. Skin and renal biopsies were diagnostic for leukocytoclastic vasculitis and pauci-immune crescentic glomerulonephritis, respectively. The patient showed a good clinical response to cocaine abstinence, and use of corticosteroids and intravenous cyclophosphamide. Last serum creatinine was 1.97 mg/dL, white blood cell count 7,420/μL, and hemoglobin level 10.8 g/dL. In levamisole-induced systemic vasculitis, the early institution of cocaine abstinence, concomitant with the use of immunosuppressive drugs in severe cases, may prevent permanent end organ damage and associate with better clinical outcomes.