Compared boron uptake and translocation in cotton cultivars

The mobility of boron (B), a commonly deficient micronutrient in cotton, has been shown to be low in the plant phloem. Nevertheless, studies have indicated that cotton cultivars can respond differently to B application. A greenhouse experiment was conducted to compare B absorption and mobility in cotton cultivars grown in nutrient solution. Treatments consisted of three cotton cultivars (FMT 701, DP 604BG and FMX 993), and five B rates (0.0, 2.5, 5.0, 10.0, and 20.0 µmol L-1). Plant growth and development were monitored for four weeks from the appearance of the first square. The time of onset and severity of B deficiency symptoms varied among cotton cultivars. Initial B uptake of cv. DP 604BG was lower than of the other cultivars, but a greater amount of available B in the nutrient solution was required to prevent deficiency symptoms in this cultivar. Boron deficiency impairs cotton growth, with no differences among cultivars, regardless of the time of appearance and intensity of B deficiency symptoms.

Macronutrient uptake, accumulation and export by the irrigated 'vitória' pineapple plant

The nutritional state of the pineapple plant has a large effect on plant growth, on fruit production, and fruit quality. The aim of this study was to assess the uptake, accumulation, and export of nutrients by the irrigated 'Vitória' pineapple plant during and at the end of its development. A randomized block statistical design with four replications was used. The treatments were defined by different times of plant collection: at 270, 330, 390, 450, 510, 570, 690, 750, and 810 days after planting (DAP). The collected plants were separated into the following components: leaves, stem, roots, fruit, and slips for determination of fresh and dry matter weight at 65 ºC. After drying, the plant components were ground for characterization of the composition and content of nutrients taken up and exported by the pineapple plant. The results were subjected to analysis of variance, and non-linear regression models were fitted for the significant differences identified by the F test (p<0.01). The leaves and the stem were the plant components that showed the greatest accumulation of nutrients. For production of 72 t ha-1 of fruit, the macronutrient accumulation in the 'Vitória' pineapple exhibited the following decreasing order: K > N > S > Ca > Mg > P, which corresponded to 898, 452, 134, 129, 126, and 107 kg ha-1, respectively, of total accumulation. The export of macronutrients by the pineapple fruit was in the following decreasing order: K > N > S > Ca > P > Mg, which was equivalent to 18, 17, 11, 8, 8, and 5 %, respectively, of the total accumulated by the pineapple. The 'Vitória' pineapple plant exported 78 kg ha-1 of N, 8 kg ha-1 of P, 164 kg ha-1 of K, 14 kg ha-1 of S, 10 kg ha-1 of Ca, and 6 kg ha-1 of Mg by the fruit. The nutrient content exported by the fruits represent important components of nutrient extraction from the soil, which need to be restored, while the nutrients contained in the leaves, stems and roots can be incorporated in the soil within a program of recycling of crop residues.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Plant growth and phosphorus uptake in mycorrhizal rangpur lime seedlings under different levels of phosphorus

The objective of this work was to evaluate the response of rangpur lime (Citrus limonia) to arbuscular mycorrhiza (Glomus intraradices), under P levels ranging from low to excessive. Plants were grown in three levels of soluble P (25, 200 and 1,000 mg kg-1), either inoculated with Glomus intraradices or left noninoculated, evaluated at 30, 60, 90, 120 and 150 days after transplanting (DAT). Total dry weight, shoot P concentration and specific P uptake by roots increased in mycorrhizal plants with the doses of 25 and 200 mg kg-1 P at 90 DAT. With 1,000 mg kg-1 P, mycorrhizal plants had a transient growth depression at 90 and 120 DAT, and nonmycorrhizal effects on P uptake at any harvesting period. Root colonization and total external mycelium correlated positively with shoot P concentration and total dry weight at the two lowest P levels. Although the highest P level decreased root colonization, it did not affect total external mycelium to the same extent. As a result, a P availability imbalance affected negatively the mycorrhizal symbiosis and, consequently, the plant growth.

Potato plant growth and macronutrient uptake as affected by soil tillage and irrigation systems

The objective of this study was to evaluate potato plant growth and macronutrient uptake, as affected by soil tillage methods, in sprinkle and drip irrigated experiments. Eight treatments were set: T1, no tillage, except for furrowing before planting; T2, one subsoiling (SS); T3, twice rotary hoeing (RH); T4, one disc plowing (DP) + twice disc harrow leveling (DL); T5, 1DP + 2DL + 1RH; T6, 1DP + 2DL + 2RH; T7, 1SS + T6; T8, one moldboard plowing (MP) + 2DL. Treatments were arranged in a randomized block design with four replications. In both irrigation systems, plants presented higher emergence velocity index (EVI), when the soil was not tillaged, and the EVI was inversely related to the maximum tuber dry mass production. In both experiments, a functional direct relationship was found between the leaf area index and maximum tuber dry mass yield. The growth of plant organs (tuber, leaf, stem and root) and the macronutrient (N, P, K, Ca and Mg) contents in potato plant responded positively to a deeper soil revolving caused by plowing, especially with moldboard plow.

Mitochondrial DNA of Nellore and European x Nellore crossing cattle of high performance

The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.

DNA barcodes for soil animal taxonomy

The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.

EXTRAÇÃO DE DNA GENÔMICO DE Passiflora spp. PARA ANÁLISES PCR-RAPD

A identificação e caracterização da diversidade genética de plantas por meio de técnicas moleculares envolvem a avaliação de vários indivíduos, necessitando-se, portanto, de métodos rápidos e precisos de extração do DNA. O co-isolamento de polissacarídeos, fenóis e compostos secundários é o principal problema encontrado no isolamento e purificação de DNA vegetal. Folhas das diversas espécies de Passiflora possuem níveis variados desses compostos que podem comprometer este procedimento. O presente estudo foi realizado com o objetivo de avaliar a qualidade e quantidade de DNA de folhas de variedades de Passiflora spp., utilizando-se de três métodos de extração. Os três métodos forneceram DNA em qualidade e quantidade suficientes para a realização da técnica PCR-RAPD.

Identificação de microssatélites para o mamoeiro por meio da exploração do banco de dados de DNA

Os marcadores microssatélites são ferramentas úteis em diversas análises genéticas em plantas. No caso do mamoeiro (Carica papaya L.), poucos locos de microssatélites foram descritos até o momento. Assim, o objetivo deste trabalho foi explorar a base de dados do GenBank / NCBI (National Center of Biotechnoloy Information) à procura de microssatélites de mamoeiro, visando a seu futuro uso em estudos genéticos e moleculares aplicados ao melhoramento genético. As seqüências foram obtidas no GenBank / NCBI, no formato FASTA, e analisadas para a presença de microssatélites com um mínimo de 20; 7 e 5 repetições dos motivos de mono-, di- e trinucleotídeos, respectivamente, e acima de 4 repetições para tetra- e pentanucleotídeos. Seqüências com mais de 90% de similaridade foram consideradas redundantes e, portanto, eliminadas das análises. Foram analisadas 44.591 seqüências, das quais 3.180 foram não-redundantes e apresentaram 3.947 microssatélites. Desse total, 3.587 foram classificados como microssatélites perfeitos, 8 imperfeitos, 65 interrompidos, 239 compostos-perfeitos, 8 compostos-imperfeitos e 40 compostos-interrompidos. As repetições de di- e trinucleotídeos representaram 65,7 e 14,4% do total de seqüências analisadas, respectivamente. Somente os motivos do tipo AT/TA representaram 44,1% dos microssatélites encontrados. Os motivos mais comuns de tri-, tetra- e pentanucleotídeos foram AAT, AATT e TTTAA, respectivamente. Observou-se que, nas seqüências disponíveis, o genoma do mamoeiro apresenta, em média, um microssatélite a cada 5,65 kb.