152 resultados para test de aprendizaje
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.