Galveston Orientation Amnesia Test (GOAT)

O trauma crânio-encefálico contuso (TCEC) é freqüentemente seguido pela amnésia pós-traumática (APT), caracterizada como um estado transitório de confusão e desorientação. Sua duração tem sido utilizada para quantificar a gravidade do TCEC e prever distúrbios nas funções cognitivas, assim como para antever as alterações na capacidade funcional das vítimas pós-trauma. O Galveston Orientation Amnesia Test (GOAT) é o primeiro instrumento sistematizado criado e o mais amplamente utilizado para avaliar a APT. Este artigo apresenta esse instrumento, as bases conceituais para seu desenvolvimento e a adaptação e validação do GOAT para cultura brasileira. Além disso, descreve sua aplicação e comenta as restrições do seu uso. Resultados de pesquisas realizadas em nosso meio contribuíram para as evidências sobre a validade do GOAT. Também apontaram os indicadores do momento pós-trauma em que o GOAT deve ser aplicado e destacaram as dificuldades no uso desse instrumento.

Evaluation of neuromotor development by means of the Harris Infant Neuromotor Test

Objective: To investigate the neuromotor development of at-risk children between three and 12 months of life, administering the Brazilian version of the Harris Infant Neuromotor Test (HINT).Method: A longitudinal study, with 78 children and 76 parents/guardians discharged from a neonatal intensive care unit in Fortaleza-CE/Brazil. Two instruments were administered: HINT and a socioeconomic questionnaire, between July/2009 to August/2010. Data from 55 preterm and 23 term children were analyzed. Results: The final mean scores ranged from 14.6 to 25.2 and from 11.2 to 24.7, for preterm and term, respectively, showing that 91% of children demonstrated good neuromotor performance; seven premature infants showed alterations which led to the referral of three children to a specialized clinic for examination and diagnostics.Conclusion: The test allowed nurses to assess infant development, identify deviations early, and plan interventions.

Use of alcohol in the elderly: transcultural validation of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G)

Objective: To evaluate the internal consistency of the version of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G) instrument, translated and adapted for Brazil. Method: This was a descriptive, cross-sectional study. Data were collected through a demographic questionnaire, the ICD-10 and the MAST-G, following the steps of translation and cultural adaptation. One hundred eleven elderly in the city of São Carlos, SP, Brazil were interviewed. Results: The mean age of those interviewed was 70 years, with 45% men and 55% women, with the mean education of three years; 92% resided with family; 48% of the subjects consumed alcoholic beverages. The MAST-G presented a good level of reliability, with Cronbach’s α = 0.7873, and good levels of sensitivity and specificity with a cutoff score of five positive responses. Conclusion: The Brazilian version of the MAST-G presented internal consistency values similar to the original English version,showing it to be adequate for use in the national context.





Improvement of a test-chamber for behavioral studies on adult females of Aedes aegypti (Linnaeus) (Diptera, Culicidae)

A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae)

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.

Qualidade do solo avaliada pelo "Soil Quality Kit Test" em dois experimentos de longa duração no Rio Grande do Sul

A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.

Soil water dynamics related to the degree of compaction of two brazilian oxisols under no-tillage

Soil water properties are related to crop growth and environmental aspects and are influenced by the degree of soil compaction. The objective of this study was to determine the water infiltration and hydraulic conductivity of saturated soil under field conditions in terms of the compaction degree of two Oxisols under a no-tillage (NT). Two commercial fields were studied in the state of Rio Grande do Sul, Brazil: one a Haplortox after 14 years under NT; the other a Hapludox after seven years under NT. Maps (50 x 30 m) of the levels of mechanical penetration resistance (PR) were drawn based on the kriging method, differentiating three compaction degrees (CD): high, intermediate and low. In each CD area, the infiltration rate (initial and steady-state) and cumulative water infiltration were measured using concentric rings, with six replications, and the saturated hydraulic conductivity (K(θs)) was determined using the Guelph permeameter. Statistical evaluation was performed based on a randomized design, using the least significant difference (LSD) test and regression analysis. The steady-state infiltration rate was not influenced by the compaction degree, with mean values of 3 and 0.39 cm h-1 in the Haplortox and the Hapludox, respectively. In the Haplortox, saturated soil hydraulic conductivity was 26.76 cm h-1 at a low CD and 9.18 cm h-1 at a high CD, whereas in the Hapludox, this value was 5.16 cm h-1 and 1.19 cm h-1 for the low and high CD, respectively. The compaction degree did not affect the initial and steady-state water infiltration rate, nor the cumulative water infiltration for either soil type, although the values were higher for the Haplortox than the Hapludox.

Pedotransfer functions to estimate proctor test parameters under different tillage systems

The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.

Portable penetrometer for agricultural soil: sensitivity test to identify critical compaction depth

To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.

Relations between soil surface roughness, tortuosity, tillage treatments, rainfall intensity and soil and water losses from a red yellow latosol

The soil surface roughness increases water retention and infiltration, reduces the runoff volume and speed and influences soil losses by water erosion. Similarly to other parameters, soil roughness is affected by the tillage system and rainfall volume. Based on these assumptions, the main purpose of this study was to evaluate the effect of tillage treatments on soil surface roughness (RR) and tortuosity (T) and to investigate the relationship with soil and water losses in a series of simulated rainfall events. The field study was carried out at the experimental station of EMBRAPA Southeastern Cattle Research Center in São Carlos (Fazenda Canchim), in São Paulo State, Brazil. Experimental plots of 33 m² were treated with two tillage practices in three replications, consisting of: untilled (no-tillage) soil (NTS) and conventionally tilled (plowing plus double disking) soil (CTS). Three successive simulated rain tests were applied in 24 h intervals. The three tests consisted of a first rain of 30 mm/h, a second of 30 mm/h and a third rain of 70 mm/h. Immediately after tilling and each rain simulation test, the surface roughness was measured, using a laser profile meter. The tillage treatments induced significant changes in soil surface roughness and tortuosity, demonstrating the importance of the tillage system for the physical surface conditions, favoring water retention and infiltration in the soil. The increase in surface roughness by the tillage treatments was considerably greater than its reduction by rain action. The surface roughness and tortuosity had more influence on the soil volume lost by surface runoff than in the conventional treatment. Possibly, other variables influenced soil and water losses from the no-tillage treatments, e.g., soil type, declivity, slope length, among others not analyzed in this study.

Soil infiltration based on bp neural network and grey relational analysis

Soil infiltration is a key link of the natural water cycle process. Studies on soil permeability are conducive for water resources assessment and estimation, runoff regulation and management, soil erosion modeling, nonpoint and point source pollution of farmland, among other aspects. The unequal influence of rainfall duration, rainfall intensity, antecedent soil moisture, vegetation cover, vegetation type, and slope gradient on soil cumulative infiltration was studied under simulated rainfall and different underlying surfaces. We established a six factor-model of soil cumulative infiltration by the improved back propagation (BP)-based artificial neural network algorithm with a momentum term and self-adjusting learning rate. Compared to the multiple nonlinear regression method, the stability and accuracy of the improved BP algorithm was better. Based on the improved BP model, the sensitive index of these six factors on soil cumulative infiltration was investigated. Secondly, the grey relational analysis method was used to individually study grey correlations among these six factors and soil cumulative infiltration. The results of the two methods were very similar. Rainfall duration was the most influential factor, followed by vegetation cover, vegetation type, rainfall intensity and antecedent soil moisture. The effect of slope gradient on soil cumulative infiltration was not significant.

Hydrological processes obtained on the plot scale under four simulated rainfall tests during the cycle of different crop systems

The cropping system influences the interception of water by plants, water storage in depressions on the soil surface, water infiltration into the soil and runoff. The aim of this study was to quantify some hydrological processes under no tillage cropping systems at the edge of a slope, in 2009 and 2010, in a Humic Dystrudept soil, with the following treatments: corn, soybeans, and common beans alone; and intercropped corn and common bean. Treatments consisted of four simulated rainfall tests at different times, with a planned intensity of 64 mm h-1 and 90 min duration. The first test was applied 18 days after sowing, and the others at 39, 75 and 120 days after the first test. Different times of the simulated rainfall and stages of the crop cycle affected soil water content prior to the rain, and the time runoff began and its peak flow and, thus, the surface hydrological processes. The depth of the runoff and the depth of the water intercepted by the crop + soil infiltration + soil surface storage were affected by the crop systems and the rainfall applied at different times. The corn crop was the most effective treatment for controlling runoff, with a water loss ratio of 0.38, equivalent to 75 % of the water loss ratio exhibited by common bean (0.51), the least effective treatment in relation to the others. Total water loss by runoff decreased linearly with an increase in the time that runoff began, regardless of the treatment; however, soil water content on the gravimetric basis increased linearly from the beginning to the end of the rainfall.

Water infiltration in an ultisol after cultivation of common bean

Water infiltration in the soil is an important hydrological process that occurs at the interface of the soil-atmosphere system; thus, the soil management practice used has a strong influence on this process. The aim of this study was to evaluate water infiltration in the soil and compare equations for estimating the water infiltration rate in an Ultisol after harvesting common bean (Phaseolus vulgaris L.) under simulated rainfall. Field tests with a rainfall simulator were carried out in three soil management systems: minimum tillage (MT), conventional tillage (CT), and no tillage (NT). In NT, four levels of plant residue on the soil surface were evaluated: 0, 3, 6, and 9 t ha-1. The models of Kostiakov-Lewis, Horton, and Philip were used to estimate the infiltration rate. In the MT system, the final infiltration rate was 54 mm h-1, whereas in the CT and NT systems with up to 3 t ha-1 of plant residue on the soil surface, the rate was near 17 mm h-1. In addition, the results indicated that in the NT system the infiltration rate increased with plant residue coverage greater than 6 t ha-1, i.e., there was a positive correlation between plant cover and the water infiltration rate. The Horton model was the most suitable in representing the water infiltration process in the soil. Therefore, this model can be recommended for estimation of this variable regardless of the soil tillage system used.

WATER INFILTRATION IN TWO CULTIVATED SOILS IN SOUTHERN BRAZIL

Infiltration is the passage of water through the soil surface, influenced by the soil type and cultivation and by the soil roughness, surface cover and water content. Infiltration absorbs most of the rainwater and is therefore crucial for planning mechanical conservation practices to manage runoff. This study determined water infiltration in two soil types under different types of management and cultivation, with simulated rainfall of varying intensity and duration applied at different times, and to adjust the empirical model of Horton to the infiltration data. The study was conducted in southern Brazil, on Dystric Nitisol (Nitossolo Bruno aluminoférrico húmico) and Humic Cambisol (Cambissolo Húmico alumínico léptico) soils to assess the following situations: simulated rains on the Nitisol from 2001 to 2012 in 31 treatments, differing in crop type, sowing direction, type of soil opener on the seeder, amount and type of crop residue and amount of liquid swine manure applied; on the Cambisol, rains were simlated from 2006 to 2012 and 18 treatments were evaluated, differing in crop, seeding direction and crop residue type. The constant of the water infiltration rate into the soil varies significantly with the soil type (30.2 mm h-1 in the Nitisol and 6.6 mm h-1 in the Cambisol), regardless of the management system, application time and rain intensity and duration. At the end of rainfalls, soil-water infiltration varies significantly with the management system, with the timing of application and rain intensity and duration, with values ranging from 13 to 59 mm h-1, in the two studied soils. The characteristics of the sowing operation in terms of relief, crop type and amount and type of crop residue influenced soil water infiltration: in the Nitisol, the values of contour and downhill seeding vary between 27 and 43 mm h-1, respectively, with crop residues of corn, wheat and soybean while in the Cambisol, the variation is between 2 and 36 mm h-1, respectively, in soybean and corn crops. The Horton model fits the values of water infiltration rate into the soil, resulting in the equation i = 30.2 + (68.2 - 30.2) e-0.0371t (R2 = 0.94**) for the Nitisol and i = 6.6 + (64.5 - 6.6) e-0.0537t (R2 = 0.99**) for the Cambisol.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.