Tuberculin skin test and interferon-gamma release assay values are associated with antimicrobial peptides expression in polymorphonuclear cells during latent tuberculous infection

It has been reported that patients with progressive tuberculosis (TB) express abundant amounts of the antimicrobial peptides (AMPs) cathelicidin (LL-37) and human neutrophil peptide-1 (HNP-1) in circulating cells, whereas latent TB infected donors showed no differences when compared with purified protein derivative (PPD) and QuantiFERON®-TB Gold (QFT)-healthy individuals. The aim of this study was to determine whether LL-37 and HNP-1 production correlates with higher tuberculin skin test (TST) and QFT values in TB household contacts. Twenty-six TB household contact individuals between 26-58 years old TST and QFT positive with at last two years of latent TB infection were recruited. AMPs production by polymorphonuclear cells was determined by flow cytometry and correlation between TST and QFT values was analysed. Our results showed that there is a positive correlation between levels of HNP-1 and LL-37 production with reactivity to TST and/or QFT levels. This preliminary study suggests the potential use of the expression levels of these peptides as biomarkers for progression in latent infected individuals.

Serial QuantiFERON-TB Gold In-Tube assay and tuberculin skin test to diagnose latent tuberculosis in household Mexican contacts: conversion and reversion rates and associated factors using conventional and borderline zone definitions

A cohort of 123 adult contacts was followed for 18‐24 months (86 completed the follow-up) to compare conversion and reversion rates based on two serial measures of QuantiFERON (QFT) and tuberculin skin test (TST) (PPD from TUBERSOL, Aventis Pasteur, Canada) for diagnosing latent tuberculosis (TB) in household contacts of TB patients using conventional (C) and borderline zone (BZ) definitions. Questionnaires were used to obtain information regarding TB exposure, TB risk factors and socio-demographic data. QFT (IU/mL) conversion was defined as <0.35 to ≥0.35 (C) or <0.35 to >0.70 (BZ) and reversion was defined as ≥0.35 to <0.35 (C) or ≥0.35 to <0.20 (BZ); TST (mm) conversion was defined as <5 to ≥5 (C) or <5 to >10 (BZ) and reversion was defined as ≥5 to <5 (C). The QFT conversion and reversion rates were 10.5% and 7% with C and 8.1% and 4.7% with the BZ definitions, respectively. The TST rates were higher compared with QFT, especially with the C definitions (conversion 23.3%, reversion 9.3%). The QFT conversion and reversion rates were higher for TST ≥5; for TST, both rates were lower for QFT <0.35. No risk factors were associated with the probability of converting or reverting. The inconsistency and apparent randomness of serial testing is confusing and adds to the limitations of these tests and definitions to follow-up close TB contacts.

Diagnostic reliability of an immunochromatographic test for Chagas disease screening at a primary health care centre in a rural endemic area

Many patients with Chagas disease live in remote communities that lack both equipment and trained personnel to perform a diagnosis by conventional serology (CS). Thus, reliable tests suitable for use under difficult conditions are required. In this study, we evaluated the ability of personnel with and without laboratory skills to perform immunochromatographic (IC) tests to detect Chagas disease at a primary health care centre (PHCC). We examined whole blood samples from 241 patients and serum samples from 238 patients. Then, we calculated the percentage of overall agreement (POA) between the two groups of operators for the sensitivity (S), specificity (Sp) and positive (PPV) and negative (NPV) predictive values of IC tests compared to CS tests. We also evaluated the level of agreement between ELISAs and indirect haemagglutination (IHA) tests. The readings of the IC test results showed 100% agreement (POA = 1). The IC test on whole blood showed the following values: S = 87.3%; Sp = 98.8%; PPV = 96.9% and NPV = 95.9%. Additionally, the IC test on serum displayed the following results: S = 95.7%; Sp = 100%; PPV = 100% and NPV = 98.2%. Using whole blood, the agreement with ELISA was 96.3% and the agreement with IHA was 94.1%. Using serum, the agreement with ELISA was 97.8% and the agreement with IHA was 96.6%. The IC test performance with serum samples was excellent and demonstrated its usefulness in a PHCC with minimal equipment. If the IC test S value and NPV with whole blood are improved, then this test could also be used in areas lacking laboratories or specialised personnel.

Mycobacterium tuberculosis epitope-specific interferon-g production in healthy Brazilians reactive and non-reactive to tuberculin skin test

The interferon (IFN)-γ response to peptides can be a useful diagnostic marker of Mycobacterium tuberculosis (MTB) latent infection. We identified promiscuous and potentially protective CD4+ T-cell epitopes from the most conserved regions of MTB antigenic proteins by scanning the MTB antigenic proteins GroEL2, phosphate-binding protein 1 precursor and 19 kDa antigen with the TEPITOPE algorithm. Seven peptide sequences predicted to bind to multiple human leukocyte antigen (HLA)-DR molecules were synthesised and tested with IFN-γ enzyme-linked immunospot (ELISPOT) assays using peripheral blood mononuclear cells (PBMCs) from 16 Mantoux tuberculin skin test (TST)-positive and 16 TST-negative healthy donors. Eighty-eight percent of TST-positive donors responded to at least one of the peptides, compared to 25% of TST-negative donors. Each individual peptide induced IFN-γ production by PBMCs from at least 31% of the TST-positive donors. The magnitude of the response against all peptides was 182 ± 230 x 106 IFN-γ spot forming cells (SFC) among TST-positive donors and 36 ± 62 x 106 SFC among TST-negative donors (p = 0.007). The response to GroEL2 (463-477) was only observed in the TST-positive group. This combination of novel MTB CD4 T-cell epitopes should be tested in a larger cohort of individuals with latent tuberculosis (TB) to evaluate its potential to diagnose latent TB and it may be included in ELISPOT-based IFN-γ assays to identify individuals with this condition.

Galveston Orientation Amnesia Test (GOAT)

O trauma crânio-encefálico contuso (TCEC) é freqüentemente seguido pela amnésia pós-traumática (APT), caracterizada como um estado transitório de confusão e desorientação. Sua duração tem sido utilizada para quantificar a gravidade do TCEC e prever distúrbios nas funções cognitivas, assim como para antever as alterações na capacidade funcional das vítimas pós-trauma. O Galveston Orientation Amnesia Test (GOAT) é o primeiro instrumento sistematizado criado e o mais amplamente utilizado para avaliar a APT. Este artigo apresenta esse instrumento, as bases conceituais para seu desenvolvimento e a adaptação e validação do GOAT para cultura brasileira. Além disso, descreve sua aplicação e comenta as restrições do seu uso. Resultados de pesquisas realizadas em nosso meio contribuíram para as evidências sobre a validade do GOAT. Também apontaram os indicadores do momento pós-trauma em que o GOAT deve ser aplicado e destacaram as dificuldades no uso desse instrumento.

Evaluation of neuromotor development by means of the Harris Infant Neuromotor Test

Objective: To investigate the neuromotor development of at-risk children between three and 12 months of life, administering the Brazilian version of the Harris Infant Neuromotor Test (HINT).Method: A longitudinal study, with 78 children and 76 parents/guardians discharged from a neonatal intensive care unit in Fortaleza-CE/Brazil. Two instruments were administered: HINT and a socioeconomic questionnaire, between July/2009 to August/2010. Data from 55 preterm and 23 term children were analyzed. Results: The final mean scores ranged from 14.6 to 25.2 and from 11.2 to 24.7, for preterm and term, respectively, showing that 91% of children demonstrated good neuromotor performance; seven premature infants showed alterations which led to the referral of three children to a specialized clinic for examination and diagnostics.Conclusion: The test allowed nurses to assess infant development, identify deviations early, and plan interventions.

Use of alcohol in the elderly: transcultural validation of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G)

Objective: To evaluate the internal consistency of the version of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G) instrument, translated and adapted for Brazil. Method: This was a descriptive, cross-sectional study. Data were collected through a demographic questionnaire, the ICD-10 and the MAST-G, following the steps of translation and cultural adaptation. One hundred eleven elderly in the city of São Carlos, SP, Brazil were interviewed. Results: The mean age of those interviewed was 70 years, with 45% men and 55% women, with the mean education of three years; 92% resided with family; 48% of the subjects consumed alcoholic beverages. The MAST-G presented a good level of reliability, with Cronbach’s α = 0.7873, and good levels of sensitivity and specificity with a cutoff score of five positive responses. Conclusion: The Brazilian version of the MAST-G presented internal consistency values similar to the original English version,showing it to be adequate for use in the national context.





Improvement of a test-chamber for behavioral studies on adult females of Aedes aegypti (Linnaeus) (Diptera, Culicidae)

A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae)

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.

Qualidade do solo avaliada pelo "Soil Quality Kit Test" em dois experimentos de longa duração no Rio Grande do Sul

A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.

Pedotransfer functions to estimate proctor test parameters under different tillage systems

The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.

Portable penetrometer for agricultural soil: sensitivity test to identify critical compaction depth

To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Conductivity test in seeds of different passion flower species

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.