Immune strategies using single-component LipL32 and multi-component recombinant LipL32-41-OmpL1 vaccines against leptospira

Genes encoding lipoproteins LipL32, LipL41 and the outer-membrane protein OmpL1 of leptospira were recombined and cloned into a pVAX1 plasmid. BALB/c mice were immunized with LipL32 and recombined LipL32-41-OmpL1 using DNA-DNA, DNA-protein and protein-protein strategies, respectively. Prime immunization was on day 1, boost immunizations were on day 11 and day 21. Sera were collected from each mouse on day 35 for antibody, cytokine detection and microscopic agglutination test while spleen cells were collected for splenocyte proliferation assay. All experimental groups (N = 10 mice per group) showed statistically significant increases in antigen-specific antibodies, in cytokines IL-4 and IL-10, as well as in the microscopic agglutination test and splenocyte proliferation compared with the pVAX1 control group. The groups receiving the recombined LipL32-41-OmpL1 vaccine induced anti-LipL41 and anti-OmpL1 antibodies and yielded better splenocyte proliferation values than the groups receiving LipL32. DNA prime and protein boost immune strategies stimulated more antibodies than a DNA-DNA immune strategy and yielded greater cytokine and splenocyte proliferation than a protein-protein immune strategy. It is clear from these results that recombination of protective antigen genes lipL32, lipL41, and ompL1 and a DNA-protein immune strategy resulted in better immune responses against leptospira than single-component, LipL32, or single DNA or protein immunization.

Immune cells and oxidative stress in the endotoxin tolerance mouse model

Sepsis is a systemic inflammatory response that can lead to tissue damage and death. In order to increase our understanding of sepsis, experimental models are needed that produce relevant immune and inflammatory responses during a septic event. We describe a lipopolysaccharide tolerance mouse model to characterize the cellular and molecular alterations of immune cells during sepsis. The model presents a typical lipopolysaccharide tolerance pattern in which tolerance is related to decreased production and secretion of cytokines after a subsequent exposure to a lethal dose of lipopolysaccharide. The initial lipopolysaccharide exposure also altered the expression patterns of cytokines and was followed by an 8- and a 1.5-fold increase in the T helper 1 and 2 cell subpopulations. Behavioral data indicate a decrease in spontaneous activity and an increase in body temperature following exposure to lipopolysaccharide. In contrast, tolerant animals maintained production of reactive oxygen species and nitric oxide when terminally challenged by cecal ligation and puncture (CLP). Survival study after CLP showed protection in tolerant compared to naive animals. Spleen mass increased in tolerant animals followed by increases of B lymphocytes and subpopulation Th1 cells. An increase in the number of stem cells was found in spleen and bone marrow. We also showed that administration of spleen or bone marrow cells from tolerant to naive animals transfers the acquired resistance status. In conclusion, lipopolysaccharide tolerance is a natural reprogramming of the immune system that increases the number of immune cells, particularly T helper 1 cells, and does not reduce oxidative stress.

Evaluation of the immune humoral response of Brazilian patients with Rubinstein-Taybi syndrome

Rubinstein-Taybi syndrome (RTS) is a rare developmental disorder characterized by craniofacial dysmorphisms, broad thumbs and toes, mental and growth deficiency, and recurrent respiratory infections. RTS has been associated with CREBBP gene mutations, but EP300 gene mutations have recently been reported in 6 individuals. In the present study, the humoral immune response in 16 RTS patients with recurrent respiratory infections of possible bacterial etiology was evaluated. No significant differences between patients and 16 healthy controls were detected to explain the high susceptibility to respiratory infections: normal or elevated serum immunoglobulin levels, normal salivary IgA levels, and a good antibody response to both polysaccharide and protein antigens were observed. However, most patients presented high serum IgM levels, a high number of total B cell and B subsets, and also high percentiles of apoptosis, suggesting that they could present B dysregulation. The CREBBP/p300 family gene is extremely important for B-cell regulation, and RTS may represent an interesting human model for studying the molecular mechanisms involved in B-cell development.

Evasion of immune responses by Trypanosoma cruzi, the etiological agent of Chagas disease

Infection with the protozoan parasite Trypanosoma cruzi leads to Chagas disease, which affects millions of people in Latin America. Infection with T. cruzi cannot be eliminated by the immune system. A better understanding of immune evasion mechanisms is required in order to develop more effective vaccines. During the acute phase, parasites replicate extensively and release immunomodulatory molecules that delay parasite-specific responses mediated by T cells. This immune evasion allows the parasite to spread in the host. In the chronic phase, parasite evasion relies on its replication strategy of hijacking the TGF-β signaling pathway involved in inflammation and tissue regeneration. In this article, the mechanisms of immune evasion described for T. cruzi are reviewed.

Amniotic fluid amino acid levels in non-immune hydrops fetalis: a case-control study

In a prospective case-control study, we compared the amniotic fluid amino acid levels in non-immune hydrops fetalis (NIHF) and normal fetuses. Eighty fetuses underwent amniocentesis for different reasons at the prenatal diagnosis unit of the Department of Obstetrics and Gynecology, Faculty of Medicine, Dicle University. Forty of these fetuses were diagnosed with NIHF. The study included 40 women each in the NIHF (mean age: 27.69 ± 4.56 years) and control (27.52 ± 5.49 years) groups, who had abnormal double- or triple-screening test values with normal fetuses with gestational ages of 23.26 ± 1.98 and 23.68 ± 1.49 weeks at the time of sample collection, respectively. Amniotic fluid amino acid concentrations (intra-assay variation: 2.26-7.85%; interassay variation: 3.45-8.22%) were measured using EZ:faast kits (EZ:faast GC/FID free (physiological) amino acid kit; Phenomenex, USA) by gas chromatography. The standard for quantitation was a mixture of free amino acids from Phenomenex. The levels of 21 amino acids were measured. The mean phosphoserine and serine levels were significantly lower in the NIHF group, while the taurine, α-aminoadipic acid (aaa), glycine, cysteine, NH4, and arginine (Arg) levels were significantly higher compared to control. Significant risk variables for the NIHF group and odds coefficients were obtained using a binary logistic regression method. The respective odds ratios and 95% confidence intervals for the risk variables phosphoserine, taurine, aaa, Arg, and NH4 were 3.31 (1.84-5.97), 2.45 (1.56-3.86), 1.78 (1.18-2.68), 2.18 (1.56-3.04), and 2.41 (1.66-3.49), respectively. The significant difference between NIHF and control fetuses suggests that the amniotic fluid levels of some amino acids may be useful for the diagnosis of NIHF.

Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Animal models of prenatal immune challenge and their contribution to the study of schizophrenia: a systematic review

Prenatal immune challenge (PIC) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism. Based on this, the goal of this article was to review the main contributions of PIC models, especially the one using the viral-mimetic particle polyriboinosinic-polyribocytidylic acid (poly-I:C), to the understanding of the etiology, biological basis and treatment of schizophrenia. This systematic review consisted of a search of available web databases (PubMed, SciELO, LILACS, PsycINFO, and ISI Web of Knowledge) for original studies published in the last 10 years (May 2001 to October 2011) concerning animal models of PIC, focusing on those using poly-I:C. The results showed that the PIC model with poly-I:C is able to mimic the prodrome and both the positive and negative/cognitive dimensions of schizophrenia, depending on the specific gestation time window of the immune challenge. The model resembles the neurobiology and etiology of schizophrenia and has good predictive value. In conclusion, this model is a robust tool for the identification of novel molecular targets during prenatal life, adolescence and adulthood that might contribute to the development of preventive and/or treatment strategies (targeting specific symptoms, i.e., positive or negative/cognitive) for this devastating mental disorder, also presenting biosafety as compared to viral infection models. One limitation of this model is the incapacity to model the full spectrum of immune responses normally induced by viral exposure.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Cocaine/levamisole-induced systemic vasculitis with retiform purpura and pauci-immune glomerulonephritis

Levamisole has been increasingly used as an adulterant of cocaine in recent years, emerging as a public health challenge worldwide. Levamisole-associated toxicity manifests clinically as a systemic vasculitis, consisting of cutaneous, hematological, and renal lesions, among others. Purpura retiform, cutaneous necrosis, intravascular thrombosis, neutropenia, and less commonly crescentic nephritis have been described in association with anti-neutrophil cytoplasmic antibodies (ANCAs) and other autoantibodies. Here we report the case of a 49-year-old male who was a chronic cocaine user, and who presented spontaneous weight loss, arthralgia, and 3 weeks before admission purpuric skin lesions in the earlobes and in the anterior thighs. His laboratory tests on admission showed serum creatinine of 4.56 mg/dL, white blood count 3,800/μL, hemoglobin 7.3 g/dL, urinalysis with 51 white blood cells/μL and 960 red blood cells/μL, and urine protein-to-creatinine ratio 1.20. Serum ANCA testing was positive (>1:320), as well as serum anti-myeloperoxidase and anti-proteinase 3 antibodies. Urine toxicology screen was positive for cocaine and levamisole, with 62.8% of cocaine, 32.2% of levamisole, and 5% of an unidentified substance. Skin and renal biopsies were diagnostic for leukocytoclastic vasculitis and pauci-immune crescentic glomerulonephritis, respectively. The patient showed a good clinical response to cocaine abstinence, and use of corticosteroids and intravenous cyclophosphamide. Last serum creatinine was 1.97 mg/dL, white blood cell count 7,420/μL, and hemoglobin level 10.8 g/dL. In levamisole-induced systemic vasculitis, the early institution of cocaine abstinence, concomitant with the use of immunosuppressive drugs in severe cases, may prevent permanent end organ damage and associate with better clinical outcomes.

LENTIL TANNIN-GLOBULIN INTERACTIONAND AND IN VITRO HYDROLYSIS

Protein fractions were isolated from lentil cotyledons and tannins were isolated and purified from lentil seed coats. The globulin fraction corresponded to 42.7% of the total lentil flour nitrogen, representing the major protein fraction. Acetone:water (7:3) was the best extractant for seed coat tannins compared to methanol or methanol-HCl 1%. Native and heated (99oC/15 min.) isolated lentil globulin and casein were hydrolyzed with trypsin and pepsin in the absence of tannins and at 1:40, 1:20, 1:10, 1:5 and 1:2.5 tannin-to-protein ratios. The tryptic and peptic hydrolysis of the unheated proteins were reduced with increasing tannin-to-protein ratios. Unheated casein showed to be more susceptible to trypsin than globulin and the opposite effect was observed with pepsin. Heating followed by tannin interaction and hydrolysis had a more pronounced effect on tryptic than peptic digestion for both proteins.

Functional characterization of acetylated Brazil nut (Bertholletia excelsa HBK) kernel globulin

Defatted Brazil nut kernel flour, a rich source of high quality proteins, is presently being utilized in the formulation of animal feeds. One of the possible ways to improve its utilization for human consumption is through improvement in its functional properties. In the present study, changes in some of the functional properties of Brazil nut kernel globulin were evaluated after acetylation at 58.6, 66.2 and 75.3% levels. The solubility of acetylated globulin was improved above pH 6.0 but was reduced in the pH range of 3.0-4.0. Water and oil absorption capacity, as well as the viscosity increased with increase in the level of acetylation. Level of modification also influenced the emulsifying capacity: decreased at pH 3.0, but increased at pH 7.0 and 9.0. Highest emulsion activity (approximately 62.2%) was observed at pH 3.0 followed by pH 9.0 and pH 7.0 and least (about 11.8%) at pH 5.0. Emulsion stability also followed similar behavior as that of emulsion activity.

Effect of chickpea (Cicer arietinum L.) germination on the major globulin content and in vitro digestibility

Chickpea seed germination was carried out over a period of 6 days. Little variation in the nitrogen and total globulin content was observed. The major globulin (11 S type) showed higher variation after the 4th day of germination. The elution behaviour and distribution of the isolated major globulin fraction on Sepharose CL-6B chromatography showed little modification at the end of germination. On SDS-PAGE the peak eluted from Sepharose CL-6B showed changes in protein bands between 20 and 30 kDa and above 60 kDa, indicating protein degradation during the period. Proteolytic activity was detected in the albumin fraction of the seeds, which increased up to the fourth and then decreased up to the sixth day, when isolated chickpea total globulin and casein were used as substrates. Chickpea flour, isolated albumin and total globulin fractions did not show an increase for in vitro digestibility; however, the isolated major globulin was more susceptible to hydrolysis after germination.