209 resultados para DNA helix


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to standardise an in-house real-time polymerase chain reaction (rtPCR) to allow quantification of hepatitis B virus (HBV) DNA in serum or plasma samples, and to compare this method with two commercial assays, the Cobas Amplicor HBV monitor and the Cobas AmpliPrep/Cobas TaqMan HBV test. Samples from 397 patients from the state of São Paulo were analysed by all three methods. Fifty-two samples were from patients who were human immunodeficiency virus and hepatitis C virus positive, but HBV negative. Genotypes were characterised, and the viral load was measure in each sample. The in-house rtPCR showed an excellent success rate compared with commercial tests; inter-assay and intra-assay coefficients correlated with commercial tests (r = 0.96 and r = 0.913, p < 0.001) and the in-house test showed no genotype-dependent differences in detection and quantification rates. The in-house assay tested in this study could be used for screening and quantifying HBV DNA in order to monitor patients during therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Triatoma sordida is a species that transmits Trypanosoma cruzi to humans. In Brazil, T. sordida currently deserves special attention because of its wide distribution, tendency to invade domestic environments and vectorial competence. For the planning and execution of control protocols to be effective against Triatominae, they must consider its population structure. In this context, this study aimed to characterise the genetic variability of T. sordida populations collected in areas with persistent infestations from Minas Gerais, Brazil. Levels of genetic variation and population structure were determined in peridomestic T. sordida by sequencing a polymorphic region of the mitochondrial cytochrome b gene. Low nucleotide and haplotype diversity were observed for all 14 sampled areas; π values ranged from 0.002-0.006. Most obtained haplotypes occurred at low frequencies, and some were exclusive to only one of the studied populations. Interpopulation genetic diversity analysis revealed strong genetic structuring. Furthermore, the genetic variability of Brazilian populations is small compared to that of Argentinean and Bolivian specimens. The possible factors related to the reduced genetic variability and strong genetic structuring obtained for studied populations are discussed in this paper.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identification based on DNA-barcoding and notes on the morphology and life history of the immature stages. The larva morphology of the species Heterobathmia pseuderiocrania (Lepidoptera, Heterobathmiidae), a Nothofagus obliqua leafminer in Chile, is described. The tissue-feeding first and last instars are described. Also, the number of larval stages, some aspects of the biology and life cycle of the species are provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A identificação e caracterização da diversidade genética de plantas por meio de técnicas moleculares envolvem a avaliação de vários indivíduos, necessitando-se, portanto, de métodos rápidos e precisos de extração do DNA. O co-isolamento de polissacarídeos, fenóis e compostos secundários é o principal problema encontrado no isolamento e purificação de DNA vegetal. Folhas das diversas espécies de Passiflora possuem níveis variados desses compostos que podem comprometer este procedimento. O presente estudo foi realizado com o objetivo de avaliar a qualidade e quantidade de DNA de folhas de variedades de Passiflora spp., utilizando-se de três métodos de extração. Os três métodos forneceram DNA em qualidade e quantidade suficientes para a realização da técnica PCR-RAPD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Os marcadores microssatélites são ferramentas úteis em diversas análises genéticas em plantas. No caso do mamoeiro (Carica papaya L.), poucos locos de microssatélites foram descritos até o momento. Assim, o objetivo deste trabalho foi explorar a base de dados do GenBank / NCBI (National Center of Biotechnoloy Information) à procura de microssatélites de mamoeiro, visando a seu futuro uso em estudos genéticos e moleculares aplicados ao melhoramento genético. As seqüências foram obtidas no GenBank / NCBI, no formato FASTA, e analisadas para a presença de microssatélites com um mínimo de 20; 7 e 5 repetições dos motivos de mono-, di- e trinucleotídeos, respectivamente, e acima de 4 repetições para tetra- e pentanucleotídeos. Seqüências com mais de 90% de similaridade foram consideradas redundantes e, portanto, eliminadas das análises. Foram analisadas 44.591 seqüências, das quais 3.180 foram não-redundantes e apresentaram 3.947 microssatélites. Desse total, 3.587 foram classificados como microssatélites perfeitos, 8 imperfeitos, 65 interrompidos, 239 compostos-perfeitos, 8 compostos-imperfeitos e 40 compostos-interrompidos. As repetições de di- e trinucleotídeos representaram 65,7 e 14,4% do total de seqüências analisadas, respectivamente. Somente os motivos do tipo AT/TA representaram 44,1% dos microssatélites encontrados. Os motivos mais comuns de tri-, tetra- e pentanucleotídeos foram AAT, AATT e TTTAA, respectivamente. Observou-se que, nas seqüências disponíveis, o genoma do mamoeiro apresenta, em média, um microssatélite a cada 5,65 kb.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

RESUMO A determinação do nível de ploidia é muito importante, principalmente em programas de melhoramento genético que envolvem poliploides, a fim de possibilitar a escolha adequada dos materiais vegetais com os quais se deseja trabalhar. A relação entre o conteúdo de DNA de acessos de bananeira e sua ploidia ainda permanece controversa na literatura; assim, o presente trabalho teve como objetivo avaliar o conteúdo de DNA de acessos de bananeira com diferentes níveis de ploidia. Foram avaliados sete acessos tetraploides, quatro triploides e quatro diploides. A determinação do conteúdo foi realizada pela técnica de citometria de fluxo. Foram trituradas entre 50-60 mg de folhas frescas, juntamente com o padrão interno (Pisum sativum) no tampão LB01, e, posteriormente, as amostras foram filtradas em gaze e filtro de 50 µm. Adicionaram-se 5 µL de RNase e 25 µL de iodeto de propídeo. Para cada amostra, foram analisados 10 mil núcleos, com três repetições. Os resultados obtidos para o conteúdo de DNA permitiram estimar o tamanho dos genomas A e B, sendo o primeiro cerca de 14% maior que o segundo. Os resultados apresentaram clara relação entre o conteúdo de DNA e o nível de ploidia dos materiais. O contéudo de DNA apresentou aumento médio de 30% nas cultivares diploides em relação às cultivares triploides avaliadas e de 25% nas cultivares triploides em relação às cultivares tetraploides. Apesar da diferença nos tamanhos dos genomas A e B, contribuições distintas desses dois genomas não foram diretamente relacionadas com alterações no conteúdo do DNA de cultivares tetraploides.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One old dream of the chemist in the field of the drug research is to create molecules capable of reaching their target with the precision of a missile. To accomplish it these molecules must have the propriety of distinguishing qualitative differences between healthy and diseased cells. A therapy based on this principle, able of eradicating specifically defective cells, or cells affected by a pathogen has an enormous advantage with the regard to the classical approach in which the cytotoxic drugs merely exploit quantitative biochemical and kinetic differences between abnormal and normal cells. We present in this article a review on the chemical synthesis of analogues of desoxyribonucleotides and on results obtained on the specific and irreversible inhibition of undesired genetic expression using the antisense principle.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

5-Aminolevulinic acid (ALA) is a heme precursor accumulated in acute intermittent porphyria (AIP), which might be associated with hepatocellular carcinoma (HCC) in symptomatic patients. Under metal catalyzed oxidation, ALA and its cyclic dimerization product, 3,6-dihydropyrazine-2,5-dipropanoic acid, produce reactive oxygen species that damage plasmid and calf thymus DNA bases, increase the steady state level of 8-oxo-7,8-dihydro-2´-deoxyguanosine in liver DNA and promote mitochondrial DNA damage. The final product of ALA, 4,5-dioxovaleric acid (DOVA), is able to alkylate guanine moieties, producing adducts. ALA and DOVA are mutagenic in bacteria. This review shows an up-to-date literature data that reinforce the hypothesis that the DNA damage induced by ALA may be associated with the development of HCC in AIP patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A number of ring-extended DNA adducts resulting from reaction of alpha,beta-unsaturated aldehydes, or their epoxides, with DNA bases have been characterized in recent years. These adducts can lead to miscoding during DNA replication which, if not repaired, result in mutations that can contribute to cancer development. Recently, the use of ultrasensitive methods allowed the detection of background levels of etheno DNA adducts in tissues of untreated animals and humans suggesting the existence of endogenous sources of reactive intermediates. In this review, we briefly summarize the recent advances in the chemistry of these DNA lesions.