163 resultados para DNA Modification Methylases
Resumo:
T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.
Resumo:
Studies on natural infection by Leishmania spp of sandflies collected in endemic and nonendemic areas can provide important information on the distribution and intensity of the transmission of these parasites. This study sought to investigate the natural infection by Leishmaniain wild female sandflies. The specimens were caught in the city of Corumbá, state of Mato Grosso do Sul (Brazil) between October 2012-March 2014, and dissected to investigate flagellates and/or submitted to molecular analysis to detect Leishmania DNA. A total of 1,164 females (77.56% of which were Lutzomyia cruzi) representing 11 species were investigated using molecular analysis; 126 specimens of Lu. cruziwere dissected and also submitted to molecular analysis. The infection rate based on the presence of Leishmania DNA considering all the sandfly species analysed was 0.69%; only Leishmania (Leishmania) amazonensis was identified in Lu. cruzi by the molecular analysis. The dissections were negative for flagellates. This is the first record of the presence of L. (L.) amazonensis DNA in Lu. cruzi, and the first record of this parasite in this area. These findings point to the need for further investigation into the possible role of this sandfly as vector of this parasite.
Resumo:
This study aimed to standardise an in-house real-time polymerase chain reaction (rtPCR) to allow quantification of hepatitis B virus (HBV) DNA in serum or plasma samples, and to compare this method with two commercial assays, the Cobas Amplicor HBV monitor and the Cobas AmpliPrep/Cobas TaqMan HBV test. Samples from 397 patients from the state of São Paulo were analysed by all three methods. Fifty-two samples were from patients who were human immunodeficiency virus and hepatitis C virus positive, but HBV negative. Genotypes were characterised, and the viral load was measure in each sample. The in-house rtPCR showed an excellent success rate compared with commercial tests; inter-assay and intra-assay coefficients correlated with commercial tests (r = 0.96 and r = 0.913, p < 0.001) and the in-house test showed no genotype-dependent differences in detection and quantification rates. The in-house assay tested in this study could be used for screening and quantifying HBV DNA in order to monitor patients during therapy.
Resumo:
Triatoma sordida is a species that transmits Trypanosoma cruzi to humans. In Brazil, T. sordida currently deserves special attention because of its wide distribution, tendency to invade domestic environments and vectorial competence. For the planning and execution of control protocols to be effective against Triatominae, they must consider its population structure. In this context, this study aimed to characterise the genetic variability of T. sordida populations collected in areas with persistent infestations from Minas Gerais, Brazil. Levels of genetic variation and population structure were determined in peridomestic T. sordida by sequencing a polymorphic region of the mitochondrial cytochrome b gene. Low nucleotide and haplotype diversity were observed for all 14 sampled areas; π values ranged from 0.002-0.006. Most obtained haplotypes occurred at low frequencies, and some were exclusive to only one of the studied populations. Interpopulation genetic diversity analysis revealed strong genetic structuring. Furthermore, the genetic variability of Brazilian populations is small compared to that of Argentinean and Bolivian specimens. The possible factors related to the reduced genetic variability and strong genetic structuring obtained for studied populations are discussed in this paper.
Resumo:
During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.
Resumo:
Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identification based on DNA-barcoding and notes on the morphology and life history of the immature stages. The larva morphology of the species Heterobathmia pseuderiocrania (Lepidoptera, Heterobathmiidae), a Nothofagus obliqua leafminer in Chile, is described. The tissue-feeding first and last instars are described. Also, the number of larval stages, some aspects of the biology and life cycle of the species are provided.
Resumo:
Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.
Resumo:
O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.
Resumo:
The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.
Resumo:
A identificação e caracterização da diversidade genética de plantas por meio de técnicas moleculares envolvem a avaliação de vários indivíduos, necessitando-se, portanto, de métodos rápidos e precisos de extração do DNA. O co-isolamento de polissacarídeos, fenóis e compostos secundários é o principal problema encontrado no isolamento e purificação de DNA vegetal. Folhas das diversas espécies de Passiflora possuem níveis variados desses compostos que podem comprometer este procedimento. O presente estudo foi realizado com o objetivo de avaliar a qualidade e quantidade de DNA de folhas de variedades de Passiflora spp., utilizando-se de três métodos de extração. Os três métodos forneceram DNA em qualidade e quantidade suficientes para a realização da técnica PCR-RAPD.
Resumo:
Os marcadores microssatélites são ferramentas úteis em diversas análises genéticas em plantas. No caso do mamoeiro (Carica papaya L.), poucos locos de microssatélites foram descritos até o momento. Assim, o objetivo deste trabalho foi explorar a base de dados do GenBank / NCBI (National Center of Biotechnoloy Information) à procura de microssatélites de mamoeiro, visando a seu futuro uso em estudos genéticos e moleculares aplicados ao melhoramento genético. As seqüências foram obtidas no GenBank / NCBI, no formato FASTA, e analisadas para a presença de microssatélites com um mínimo de 20; 7 e 5 repetições dos motivos de mono-, di- e trinucleotídeos, respectivamente, e acima de 4 repetições para tetra- e pentanucleotídeos. Seqüências com mais de 90% de similaridade foram consideradas redundantes e, portanto, eliminadas das análises. Foram analisadas 44.591 seqüências, das quais 3.180 foram não-redundantes e apresentaram 3.947 microssatélites. Desse total, 3.587 foram classificados como microssatélites perfeitos, 8 imperfeitos, 65 interrompidos, 239 compostos-perfeitos, 8 compostos-imperfeitos e 40 compostos-interrompidos. As repetições de di- e trinucleotídeos representaram 65,7 e 14,4% do total de seqüências analisadas, respectivamente. Somente os motivos do tipo AT/TA representaram 44,1% dos microssatélites encontrados. Os motivos mais comuns de tri-, tetra- e pentanucleotídeos foram AAT, AATT e TTTAA, respectivamente. Observou-se que, nas seqüências disponíveis, o genoma do mamoeiro apresenta, em média, um microssatélite a cada 5,65 kb.