An in-house real-time polymerase chain reaction: standardisation and comparison with the Cobas Amplicor HBV monitor and Cobas AmpliPrep/Cobas TaqMan HBV tests for the quantification of hepatitis B virus DNA

This study aimed to standardise an in-house real-time polymerase chain reaction (rtPCR) to allow quantification of hepatitis B virus (HBV) DNA in serum or plasma samples, and to compare this method with two commercial assays, the Cobas Amplicor HBV monitor and the Cobas AmpliPrep/Cobas TaqMan HBV test. Samples from 397 patients from the state of São Paulo were analysed by all three methods. Fifty-two samples were from patients who were human immunodeficiency virus and hepatitis C virus positive, but HBV negative. Genotypes were characterised, and the viral load was measure in each sample. The in-house rtPCR showed an excellent success rate compared with commercial tests; inter-assay and intra-assay coefficients correlated with commercial tests (r = 0.96 and r = 0.913, p < 0.001) and the in-house test showed no genotype-dependent differences in detection and quantification rates. The in-house assay tested in this study could be used for screening and quantifying HBV DNA in order to monitor patients during therapy.

Assessing the mitochondrial DNA diversity of the Chagas disease vector Triatoma sordida (Hemiptera: Reduviidae)

Triatoma sordida is a species that transmits Trypanosoma cruzi to humans. In Brazil, T. sordida currently deserves special attention because of its wide distribution, tendency to invade domestic environments and vectorial competence. For the planning and execution of control protocols to be effective against Triatominae, they must consider its population structure. In this context, this study aimed to characterise the genetic variability of T. sordida populations collected in areas with persistent infestations from Minas Gerais, Brazil. Levels of genetic variation and population structure were determined in peridomestic T. sordida by sequencing a polymorphic region of the mitochondrial cytochrome b gene. Low nucleotide and haplotype diversity were observed for all 14 sampled areas; π values ranged from 0.002-0.006. Most obtained haplotypes occurred at low frequencies, and some were exclusive to only one of the studied populations. Interpopulation genetic diversity analysis revealed strong genetic structuring. Furthermore, the genetic variability of Brazilian populations is small compared to that of Argentinean and Bolivian specimens. The possible factors related to the reduced genetic variability and strong genetic structuring obtained for studied populations are discussed in this paper.

Functional complementation of Leishmania (Leishmania) amazonensis AP endonuclease gene (lamap) in Escherichia coli mutant strains challenged with DNA damage agents

During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.

Os fundos setoriais e a redefiniçao do modelo de promoção de ciência, tecnologia e inovação no Brasil: uma análise à luz do CT-Agro

RESUMOO objetivo neste trabalho é analisar se os Fundos Setoriais redefiniram o modelo de promoção de Ciência, Tecnologia e Inovação (CT&I), mudando de ofertista-linear para o modelo sistêmico, como previsto em sua concepção. Para a consolidação desse modelo, o setor produtivo precisa estar inserido no processo inovativo. Dessa forma, apoiou-se na análise da presença ou não da empresa em dois objetos dos Fundos Sociais. Os resultados apontam que nem as agências de fomento, nem os projetos aprovados têm buscado estimular a cooperação universidade-empresa. Assim, o que se verifica é que não houve uma redefinição para o modelo sistêmico de inovação, e sim que a política de promoção de CT&I continua a seguir um modelo linear, mas agora induzido pela demanda.

Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identificación basada en DNA-barcoding y notas morfológicas e historia de vida de los estados inmaduros

Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identification based on DNA-barcoding and notes on the morphology and life history of the immature stages. The larva morphology of the species Heterobathmia pseuderiocrania (Lepidoptera, Heterobathmiidae), a Nothofagus obliqua leafminer in Chile, is described. The tissue-feeding first and last instars are described. Also, the number of larval stages, some aspects of the biology and life cycle of the species are provided.

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

Caracterização do dna ribossômico do isolado de Scleroderma UFSMSc1 de Eucalyptus grandis W. Hill ex-maiden

O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Mitochondrial DNA of Nellore and European x Nellore crossing cattle of high performance

The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.

DNA barcodes for soil animal taxonomy

The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.