262 resultados para Berg test
Resumo:
Objective: To evaluate the internal consistency of the version of the Michigan Alcoholism Screening Test – Geriatric Version (MAST-G) instrument, translated and adapted for Brazil. Method: This was a descriptive, cross-sectional study. Data were collected through a demographic questionnaire, the ICD-10 and the MAST-G, following the steps of translation and cultural adaptation. One hundred eleven elderly in the city of São Carlos, SP, Brazil were interviewed. Results: The mean age of those interviewed was 70 years, with 45% men and 55% women, with the mean education of three years; 92% resided with family; 48% of the subjects consumed alcoholic beverages. The MAST-G presented a good level of reliability, with Cronbach’s α = 0.7873, and good levels of sensitivity and specificity with a cutoff score of five positive responses. Conclusion: The Brazilian version of the MAST-G presented internal consistency values similar to the original English version,showing it to be adequate for use in the national context.
Resumo:
Pyranthe acaciae Berg, 1883 and Hemiptycha chilensis Spinola, 1852 are reinstated in Sundarion Kirkaldy, 1904 (formerly in synonymy of Callicentrus bonasia (Fabricius, 1775) (Centrotinae, Nessorhinini)). Pyranthe frustratoria Berg, 1883 (also formerly considered as synonym of Callicentrus bonasia) becomes a new synonym of Sundarion flavomarginatum (Fairmaire, 1846).
Resumo:
A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.
Resumo:
Hydrometra argentina Berg, 1879, H. caraiba Guérin-Méneville, 1857 and H. guianana Hungerford & Evans, 1934 are newly recorded in the Amazon River floodplain, Brazil. A redescription of H. argentina is also given, as the original description is incomplete. A key to the three known species occurring in this region is provided. Hydrometra argentina can be distinguished from H. caraiba and H. guianana by the body length smaller than 12.50 mm, anteoculus/postoculus ratio between 1.80 and 2.00, clypeus narrow and conical, metacetabulum with no circular pits, and projections on male abdominal sternite VI in the shape of simple spines. The other species can be distinguished mainly by the anteoculus/postoculus ratio and position of projections on male abdominal sternite VI.
Resumo:
An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.
Resumo:
A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.
Resumo:
The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.
Resumo:
To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.
Resumo:
Knowledge of the soil water retention curve (SWRC) is essential for understanding and modeling hydraulic processes in the soil. However, direct determination of the SWRC is time consuming and costly. In addition, it requires a large number of samples, due to the high spatial and temporal variability of soil hydraulic properties. An alternative is the use of models, called pedotransfer functions (PTFs), which estimate the SWRC from easy-to-measure properties. The aim of this paper was to test the accuracy of 16 point or parametric PTFs reported in the literature on different soils from the south and southeast of the State of Pará, Brazil. The PTFs tested were proposed by Pidgeon (1972), Lal (1979), Aina & Periaswamy (1985), Arruda et al. (1987), Dijkerman (1988), Vereecken et al. (1989), Batjes (1996), van den Berg et al. (1997), Tomasella et al. (2000), Hodnett & Tomasella (2002), Oliveira et al. (2002), and Barros (2010). We used a database that includes soil texture (sand, silt, and clay), bulk density, soil organic carbon, soil pH, cation exchange capacity, and the SWRC. Most of the PTFs tested did not show good performance in estimating the SWRC. The parametric PTFs, however, performed better than the point PTFs in assessing the SWRC in the tested region. Among the parametric PTFs, those proposed by Tomasella et al. (2000) achieved the best accuracy in estimating the empirical parameters of the van Genuchten (1980) model, especially when tested in the top soil layer.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.
Resumo:
Frutos de um pomar comercial composto por progênies de duas plantas matrizes foram avaliados, com o objetivo de caracterizar a variabilidade fenotípica. As características peso de fruto, diâmetro e sólidos solúveis totais apresentaram diferenças estatísticas significativas entre as médias de famílias em pelo menos dois dos anos avaliados, enquanto para comprimento e rendimento de polpa a diferença não foi significativa. Houve diferença significativa entre médias de anos, dentro de cada família, para todas as características, com exceção das médias de peso de fruto entre 1998 e 1999 nas duas famílias e as médias de sólidos solúveis totais entre 1998 e 1999 em uma família e entre 1999 e 2000 na outra família. As correlações e regressões entre características produtivas mais relevantes foram obtidas entre peso de fruto e peso de casca, peso de fruto e comprimento, peso de fruto e diâmetro, peso de casca e comprimento, peso de casca e diâmetro e comprimento e diâmetro.
Resumo:
A goiabeira-serrana (Acca sellowiana Berg.) é uma mirtácea nativa do planalto meridional brasileiro, com dispersão secundária no Uruguai, e produz um fruto de sabor único. Plantas de um pomar comercial composto por duas famílias de meios-irmãos (FMI1 e FMI2) foram avaliadas, com o objetivo principal de analisar a variabilidade fenotípica de várias características. As médias (± desvio-padrão) obtidas para as características avaliadas, no ano de 2000, foram: produtividade (29,2±35,0 e 55,1±53,4 frutos por planta); altura (2,2±0,7 m e 2,7±0,8 m); diâmetro de copa (1,9±0,7 m e 2,1±0,7 m); número de ramificações a 20 cm do solo (2,4±1,5 e 1,6±1,2) e distância entre o estigma e as anteras na flor (0,5±0,2 cm e 0,2±0,2 cm), para as plantas da FMI1 e da FMI2, respectivamente. As avaliações revelaram diferenças estatisticamente significativas entre as duas famílias para as características avaliadas, com exceção de diâmetro de copa. As correlações entre características vegetativas não foram estatisticamente significativas, com exceção da correlação entre a altura e a distância entre estigma e anteras (r=-0,53) para a FMI1, no ano de 2000. As regressões não foram significativas, com exceção da regressão entre altura e produtividade na FMI1, em 1998, e entre a produtividade e a distância entre estigma e anteras na FMI2, em 2000. Porém, todas apresentaram coeficientes de determinação inferiores a 0,15.
Resumo:
Acca sellowiana (Myrtaceae) é uma frutífera nativa da região Sul do Brasil e nordeste do Uruguai, que vem despertando grande interesse devido ao alto potencial organoléptico de seus frutos. Neste trabalho, teve-se como objetivo a caracterização do tipo de sistema de incompatibilidade atuante em A. sellowiana, através da avaliação do desenvolvimento dos tubos polínicos. Utilizaram-se dois acessos: 458, sendo autocompatível, e 101, auto-incompatível. A maior porcentagem de germinação de grãos de pólen foi observada no acesso 101, com 68,8% de grãos de pólen germinados. Não foram observadas diferenças no crescimento dos tubos polínicos em pistilos autopolinizados ou de polinização cruzada, em ambos os acessos. O crescimento completo do tubo polínico até o ovário ocorreu em pistilos coletados 96 horas após a polinização, independentemente do tratamento aplicado. Sugere-se a ocorrência de auto-esterilidade ou auto-incompatibilidade tardia ou pós-zigótica, considerando que o abortamento dos frutos de A. sellowiana é uniforme e ocorre num prazo curto, por volta de 20 a 30 dias após a fertilização das flores.
Resumo:
A Acca sellowiana Berg. (Myrtaceae) é uma frutífera nativa dos planaltos meridionais do Sul do Brasil e que se encontra em processo de domesticação. Seus frutos são doce-acidulados e podem ser consumidos in natura ou empregados para a produção de sucos e doces. Assim, informações sobre o desenvolvimento, morfologia e anatomia de seus frutos são de grande interesse e foram objetos do presente trabalho. O fruto (ovário mais hipanto), no tempo zero (plena floração), tem, em média, 0,6 cm de altura e 0,4 cm de diâmetro, sendo cerca de dez vezes menor que o fruto maduro. Longitudinalmente, identificam-se três regiões distintas: locular, sublocular e prolongamento. Transversalmente, na região mediana, estão delimitadas três regiões: 1) epiderme (casca): com tricomas unicelulares e simples; 2) região parenquimática: rica em braquiesclereídes, isoladas ou em pequenos grupos (2-3 células), com oito feixes vasculares concêntricos perifloemáticos distribuídos radialmente e muitas glândulas esféricas subepidérmicas; 3) região interna (polpa): com células pequenas, cúbicas, nitidamente dispostas em 3-4 camadas ao redor dos lóculos, várias contendo drusa. Quatro lóculos são separados pelos septos e vários óvulos nascem de placentas axiais, com duas fileiras por lóculo. Não ocorrem nectários. À medida que o fruto se desenvolve, surgem, na região intermediária, grupos de células de paredes finas, que crescem muito e diferenciam-se em braquiesclereídes. As placentas crescem, ocupando todo o espaço interior dos lóculos à medida que estes aumentam de tamanho e as sementes se desenvolvem. Assim, o fruto maduro apresenta uma região periférica de consistência firme e gosto adstringente, e uma região central macia e adocicada.