176 resultados para 947
Resumo:
A dendritic cell (DC)-based vaccine strategy could reduce the risk of recurrence and improve the survival of breast cancer patients. However, while therapy-induced apoptosis of hepatocellular and colorectal carcinoma cells can enhance maturation and antigen presentation of DCs, whether this effect occurs in breast cancer is currently unknown. In the present study, we investigated the effect of doxorubicin (ADM)-induced apoptotic MCF-7 breast cancer cells on the activation of DCs. ADM-induced apoptotic MCF-7 cells could effectively induce immature DC (iDC) maturation. The mean fluorescence intensity (MFI) of DC maturity marker CD83 was 23.3 in the ADM-induced apoptotic MCF-7 cell group compared with 8.5 in the MCF-7 cell group. The MFI of DC co-stimulatory marker CD86 and HLA-DR were also increased after iDCs were treated with ADM-induced apoptotic MCF-7 cells. Furthermore, the proliferating autologous T-lymphocytes increased from 14.2 to 40.3% after incubated with DCs induced by apoptotic MCF-7 cells. The secretion of interferon-947; by these T-lymphocytes was also increased. In addition, cell-cell interaction between apoptotic MCF-7 cells and iDCs, but not soluble factors released by apoptotic MCF-7 cells, was crucial for the maturation of iDCs. These findings constitute a novel in vitro DC-based vaccine strategy for the treatment of breast cancer by ADM-induced apoptotic MCF-7 cells.
Resumo:
We have described a case of a patient with an intriguing association of mucocutaneous leishmaniasis with lepromatous leprosy, two opposite polar forms of these spectral diseases. In the present follow-up study, we investigated the effect of the addition of Mycobacterium leprae antigens on interferon-gamma (IFN-947;) production in Leishmania antigen-stimulated cultures of peripheral blood mononuclear cells (PBMC) from this patient. For this purpose, PBMC cultures were stimulated with crude L. braziliensis and/or M. leprae whole-cell antigen extracts or with concanavalin A. In some experiments, neutralizing anti-human interleukin (IL)-10 antibodies were added to the cultures. IFN-947; and IL-10 levels in culture supernatants were measured by ELISA. During active leprosy, M. leprae antigens induced 72.3% suppression of the IFN-947; response to L. braziliensis antigen, and this suppression was abolished by IL-10 neutralization. Interestingly, the suppressive effect of M. leprae antigen was lost after the cure of leprosy and the disappearance of this effect was accompanied by exacerbation of mucosal leishmaniasis. Considered together, these results provide evidence that the concomitant lepromatous leprosy induced an IL-10-mediated regulatory response that controlled the immunopathology of mucosal leishmaniasis, demonstrating that, in the context of this coinfection, the specific immune response to one pathogen can influence the immune response to the other pathogen and the clinical course of the disease caused by it. Our findings may contribute to a better understanding of the Leishmania/M. leprae coinfection and of the immunopathogenesis of mucosal leishmaniasis.
Resumo:
In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-947; but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.
Resumo:
Hashimoto’s thyroiditis (HT) is considered to be mediated mainly by Th1 cells, but it is not known whether Graves’ disease (GD) is associated with Th1 or Th2 predominance. Th17 cells, a novel subset of Th cells, play a crucial role in the pathogenesis of various autoimmune disorders. In the present study, the expression of IL-17A and IFN-947; was investigated in patients with HT or GD. mRNA expression of IL-17A and IFN-947; in peripheral blood mononuclear cells (PBMC) from 43 patients with autoimmune thyroid disease (AITD) and in thyroid tissues from 40 AITD patients were measured by real-time qRT-PCR. The protein expression of IL-17A and IL-23p19 was examined by immunohistochemistry in thyroid tissues from 28 AITD patients. The mRNA levels of IL-17A and IFN-947; were higher in both PBMC and thyroid tissues of HT patients than in controls (mRNA levels are reported as the cytokine/β-actin ratio: IL-17 = 13.58- and 2.88-fold change and IFN-947; = 16.54- and 2.74-fold change, respectively, P < 0.05). Also, the mRNA levels of IL-17A and IFN-947; did not differ significantly in GD patients (P > 0.05). The high protein expression of IL-17A (IOD = 15.17 ± 4.8) and IL-23p19 (IOD = 16.84 ± 7.87) in HT was confirmed by immunohistochemistry (P < 0.05). The similar high levels of IL-17A and IFN-947; suggest a mixed response of Th17 and Th1 in HT, where both cells may play important roles in the destruction procedure by cell-mediated cytotoxicity.
Resumo:
An important disease among human metabolic disorders is type 2 diabetes mellitus. This disorder involves multiple physiological defects that result from high blood glucose content and eventually lead to the onset of insulin resistance. The combination of insulin resistance, increased glucose production, and decreased insulin secretion creates a diabetic metabolic environment that leads to a lifetime of management. Appropriate models are critical for the success of research. As such, a unique model providing insight into the mechanisms of reversible insulin resistance is mammalian hibernation. Hibernators, such as ground squirrels and bats, are excellent examples of animals exhibiting reversible insulin resistance, for which a rapid increase in body weight is required prior to entry into dormancy. Hibernator studies have shown differential regulation of specific molecular pathways involved in reversible resistance to insulin. The present review focuses on this growing area of research and the molecular mechanisms that regulate glucose homeostasis, and explores the roles of the Akt signaling pathway during hibernation. Here, we propose a link between hibernation, a well-documented response to periods of environmental stress, and reversible insulin resistance, potentially facilitated by key alterations in the Akt signaling network, PPAR-947;/PGC-1α regulation, and non-coding RNA expression. Coincidentally, many of the same pathways are frequently found to be dysregulated during insulin resistance in human type 2 diabetes. Hence, the molecular networks that may regulate reversible insulin resistance in hibernating mammals represent a novel approach by providing insight into medical treatment of insulin resistance in humans.
Resumo:
We investigated the effect of fish oil (FO) supplementation on tumor growth, cyclooxygenase 2 (COX-2), peroxisome proliferator-activated receptor gamma (PPAR947;), and RelA gene and protein expression in Walker 256 tumor-bearing rats. Male Wistar rats (70 days old) were fed with regular chow (group W) or chow supplemented with 1 g/kg body weight FO daily (group WFO) until they reached 100 days of age. Both groups were then inoculated with a suspension of Walker 256 ascitic tumor cells (3×107 cells/mL). After 14 days the rats were killed, total RNA was isolated from the tumor tissue, and relative mRNA expression was measured using the 2-ΔΔCT method. FO significantly decreased tumor growth (W=13.18±1.58 vsWFO=5.40±0.88 g, P<0.05). FO supplementation also resulted in a significant decrease in COX-2 (W=100.1±1.62 vsWFO=59.39±5.53, P<0.001) and PPAR947; (W=100.4±1.04vs WFO=88.22±1.46, P<0.05) protein expression. Relative mRNA expression was W=1.06±0.022 vsWFO=0.31±0.04 (P<0.001) for COX-2, W=1.08±0.02vs WFO=0.52±0.08 (P<0.001) for PPAR947;, and W=1.04±0.02 vs WFO=0.82±0.04 (P<0.05) for RelA. FO reduced tumor growth by attenuating inflammatory gene expression associated with carcinogenesis.
Resumo:
Our objective was to investigate the protective effect of Lawesson's reagent, an H2S donor, against alendronate (ALD)-induced gastric damage in rats. Rats were pretreated with saline or Lawesson's reagent (3, 9, or 27 µmol/kg, po) once daily for 4 days. After 30 min, gastric damage was induced by ALD (30 mg/kg) administration by gavage. On the last day of treatment, the animals were killed 4 h after ALD administration. Gastric lesions were measured using a computer planimetry program, and gastric corpus pieces were assayed for malondialdehyde (MDA), glutathione (GSH), proinflammatory cytokines [tumor necrosis factor (TNF)-α and interleukin (IL)-1β], and myeloperoxidase (MPO). Other groups were pretreated with glibenclamide (5 mg/kg, ip) or with glibenclamide (5 mg/kg, ip)+diazoxide (3 mg/kg,ip). After 1 h, 27 µmol/kg Lawesson's reagent was administered. After 30 min, 30 mg/kg ALD was administered. ALD caused gastric damage (63.35±9.8 mm2); increased levels of TNF-α, IL-1β, and MDA (2311±302.3 pg/mL, 901.9±106.2 pg/mL, 121.1±4.3 nmol/g, respectively); increased MPO activity (26.1±3.8 U/mg); and reduced GSH levels (180.3±21.9 µg/g). ALD also increased cystathionine-947;-lyase immunoreactivity in the gastric mucosa. Pretreatment with Lawesson's reagent (27 µmol/kg) attenuated ALD-mediated gastric damage (15.77±5.3 mm2); reduced TNF-α, IL-1β, and MDA formation (1502±150.2 pg/mL, 632.3±43.4 pg/mL, 78.4±7.6 nmol/g, respectively); lowered MPO activity (11.7±2.8 U/mg); and increased the level of GSH in the gastric tissue (397.9±40.2 µg/g). Glibenclamide alone reversed the gastric protective effect of Lawesson's reagent. However, glibenclamide plus diazoxide did not alter the effects of Lawesson's reagent. Our results suggest that Lawesson's reagent plays a protective role against ALD-induced gastric damage through mechanisms that depend at least in part on activation of ATP-sensitive potassium (KATP) channels.
Resumo:
Paracoccidioidomycosis (PCM) is a chronic systemic mycosis caused by the inhalation of the thermally dimorphic fungus Paracoccidioides brasiliensis as well as the recently described P. lutzii. Because the primary infection occurs in the lungs, we investigated the differential involvement of the right and left lungs in experimental P. brasiliensis infection. Lungs were collected from C57BL/6 mice at 70 days after intravenous infection with 1×106 yeast cells of a virulent strain of P. brasiliensis (Pb18). The left lung, which in mice is smaller and has fewer lobes than the right lung, yielded increased fungal recovery associated with a predominant interleukin-4 response and diminished synthesis of interferon-947; and nitric oxide compared with the right lung. Our data indicate differential involvement of the right and left lungs during experimental PCM. This knowledge emphasizes the need for an accurate, standardized protocol for tissue collection during studies of experimental P. brasiliensis infection, since experiments using the same lungs favor the collection of comparable data among different mice.
Resumo:
The immunostimulatory properties of inactivated Parapoxvirus ovis (iPPVO) have long been investigated in different animal species and experimental settings. In this study, we investigated the effects of iPPVO on cytokine expression in mice after intraperitoneal inoculation. Spleen and sera collected from iPPVO-treated mice at intervals after inoculation were submitted to cytokine mRNA determination by real-time PCR (qPCR), serum protein concentration by ELISA, and interferon (IFN)-α/β activity by bioassay. The spleen of iPPVO-treated animals showed a significant increase in mRNA expression of all cytokines assayed, with different kinetics and magnitude. Proinflammatory cytokines interleukin (IL)-1β, tumor necrosis factor-alpha (TNF-α), and IL-8 mRNA peaked at 24 hours postinoculation (hpi; 5.4-fold increase) and 48 hpi (3- and 10-fold increases), respectively. A 15-fold increase in IFN-947; and 6-fold IL-12 mRNA increase were detected at 48 and 24 hpi, respectively. Increased expression of autoregulatory cytokines (Th2), mainly IL-10 and IL-4, could be detected at later times (72 and 96 hpi) with peaks of 4.7- and 4.9-fold increases, respectively. IFN-I antiviral activity against encephalomyocarditis virus was demonstrated in sera of treated animals between 6 and 12 hpi, with a >90% reduction in the number of plaques. Measurement of serum proteins by ELISA revealed increased levels of IL-1, TNF-α, IL-12, IFN-947;, and IL-10, with kinetics similar to those observed by qPCR, especially for IL-12 and IFN-947;. These data demonstrate that iPPVO induced a transient and complex cytokine response, initially represented by Th1-related cytokines followed by autoregulatory and Th2 cytokines.
Resumo:
The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation and myocardial no-reflow. Twenty-four New Zealand white male rabbits (5-6 months old) were randomized to three groups of eight: a sham-operated group, an AMI/R group, and an atorvastatin-treated group (10 mg/kg). Animals in the latter two groups were subjected to 4 h of coronary occlusion followed by 2 h of reperfusion. Serum levels of interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay. The expression of interferon gamma (IFN-947;) in normal and infarcted (reflow and no-reflow) myocardial tissue was determined by immunohistochemical methods. The area of no-reflow and necrosis was evaluated pathologically. Levels of serum IL-6 were significantly lower in the atorvastatin group than in the AMI/R group (P<0.01). Expression of IFN-947; in infarcted reflow and no-reflow myocardial tissue was also significantly lower in the atorvastatin group than in the AMI/R group. The mean area of no-reflow [47.01% of ligation area (LA)] was significantly smaller in the atorvastatin group than in the AMI/R group (85.67% of LA; P<0.01). The necrosis area was also significantly smaller in the atorvastatin group (85.94% of LA) than in the AMI/R group (96.56% of LA; P<0.01). In a secondary analysis, rabbits in the atorvastatin and AMI/R groups were divided into two groups based on necrosis area (90% of LA): a small group (<90% of LA) and a large group (>90% of LA). There was no significant difference in the area of no-reflow between the small (61.40% of LA) and large groups (69.87% of LA; P>0.05). Single-dose atorvastatin protected against inflammation and myocardial no-reflow and reduced infarct size during AMI/R in rabbits. No-reflow was not dependent on the reduction of infarct size.
Resumo:
Anastomotic dehiscence is the most severe complication of colorectal surgery. Metalloproteinases (MMPs) and interleukins (ILs) can be used to analyze the healing process of anastomosis. To evaluate the effects of bromopride on MMP and cytokine gene expression in left colonic anastomoses in rats with or without induced abdominal sepsis, 80 rats were divided into two groups for euthanasia on the third or seventh postoperative day (POD). They were then divided into subgroups of 20 rats for sepsis induction or not, and then into subgroups of 10 rats for administration of bromopride or saline. Left colonic anastomosis was performed and abdominal sepsis was induced by cecal ligation and puncture. A colonic segment containing the anastomosis was removed for analysis of gene expression of MMP-1α, MMP-8, MMP-13, IL-β, IL-6, IL-10, tumor necrosis factor-α (TNF-α), and interferon-947; (IFN-947;). On the third POD, bromopride was associated with increased MMP-1α, MMP-13, IL-6, IFN-947;, and IL-10 gene expression. On the seventh POD, all MMP transcripts became negatively modulated and all IL transcripts became positively modulated. In the presence of sepsis, bromopride administration increased MMP-8 and IFN-947; gene expression and decreased MMP-1, TNF-α, IL-6, and IL-10 gene expression on the third POD. On the seventh POD, we observed increased expression of MMP-13 and all cytokines, except for TNF-α. In conclusion, bromopride interferes with MMP and IL gene expression during anastomotic healing. Further studies are needed to correlate these changes with the healing process.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-947;) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-947; (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-947; expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The purpose of this study was to explore cytokine expression patterns and cytogenetic abnormalities of mesenchymal stem cells (MSCs) from the bone marrow microenvironment of Chinese patients with myelodysplastic syndromes (MDS). Bone marrow samples were obtained from 30 cases of MDS (MDS group) and 30 healthy donors (control group). The expression pattern of cytokines was detected by customized protein array. The karyotypes of MSCs were analyzed using fluorescence in situ hybridization. Compared with the control group, leukemia inhibitory factor, stem cell factor (SCF), stromal cell-derived factor (SDF-1), bone morphogenetic protein 4, hematopoietic stem cell (HSC) stimulating factor, and transforming growth factor-β in the MDS group were significantly downregulated (P<0.05), while interferon-947; (IFN-947;), tumor necrosis factor-α (TNF-α), and programmed death ligand (B7-H1) were significantly upregulated (P<0.05). For chromosome abnormality analysis, the detection rate of abnormal karyotypes (+8, -8, -20, 20q-, -Y, -7, 5q-) was 30% in the MDS group and 0% in the control group. In conclusion, the up- and downregulated expression of these cytokines might play a key role in the pathogenesis of MDS. Among them, SCF and SDF-1 may play roles in the apoptosis of HSCs in MDS; and IFN-947;, TNF-α, and B7-H1 may be associated with apoptosis of bone marrow cells in MDS. In addition, the abnormal karyotypes might be actively involved in the pathogenesis of MDS. Further studies are required to determine the role of abnormal karyotypes in the occurrence and development of MDS.
Hydrogen sulfide in posthemorrhagic shock mesenteric lymph drainage alleviates kidney injury in rats
Resumo:
Posthemorrhagic shock mesenteric lymph (PHSML) is a key factor in multiple organ injury following hemorrhagic shock. We investigated the role of hydrogen sulfide (H2S) in PHSML drainage in alleviating acute kidney injury (AKI) by administering D,L-propargylglycine (PPG) and sodium hydrosulfide hydrate (NaHS) to 12 specific pathogen-free male Wistar rats with PHSML drainage. A hemorrhagic shock model was established in 4 experimental groups: shock, shock+drainage, shock+drainage+PPG (45 mg/kg, 0.5 h prehemorrhage), and shock+drainage+NaHS (28 µmol/kg, 0.5 h prehemorrhage). Fluid resuscitation was performed after 1 h of hypotension, and PHMSL was drained in the last three groups for 3 h after resuscitation. Renal function and histomorphology were assessed along with levels of H2S, cystathionine-947;-lyase (CSE), Toll-like receptor 4 (TLR4), interleukin (IL)-10, IL-12, and tumor necrosis factor (TNF)-α in renal tissue. Hemorrhagic shock induced AKI with increased urea and creatinine levels in plasma and higher H2S, CSE, TLR4, IL-10, IL-12, and TNF-α levels in renal tissue. PHSML drainage significantly reduced urea, creatinine, H2S, CSE, and TNF-α but not TLR4, IL-10, or IL-12. PPG decreased creatinine, H2S, IL-10, and TNF-α levels, but this effect was reversed by NaHS administration. In conclusion, PHSML drainage alleviated AKI following hemorrhagic shock by preventing increases in H2S and H2S-mediated inflammation.
Resumo:
In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon 947;, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.