258 resultados para zellfreie DNA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since 1984, Anopheles (Kerteszia) lepidotus has been considered a mosquito species that is involved in the transmission of malaria in Colombia, after having been incriminated as such with epidemiological evidence from a malaria outbreak in Cunday-Villarrica, Tolima. Subsequent morphological analyses of females captured in the same place and at the time of the outbreak showed that the species responsible for the transmission was not An. lepidotus, but rather Anopheles pholidotus. However, the associated morphological stages and DNA sequences of An. pholidotus from the foci of Cunday-Villarrica had not been analysed. Using samples that were caught recently from the outbreak region, the purpose of this study was to provide updated and additional information by analysing the morphology of female mosquitoes, the genitalia of male mosquitoes and fourth instar larvae of An. pholidotus, which was confirmed with DNA sequences of cytochrome oxidase I and rDNA internal transcribed spacer. A total of 1,596 adult females were collected in addition to 37 larval collections in bromeliads. Furthermore, 141 adult females, which were captured from the same area in the years 1981-1982, were analysed morphologically. Ninety-five DNA sequences were analysed for this study. Morphological and molecular analyses showed that the species present in this region corresponds to An. pholidotus. Given the absence of An. lepidotus, even in recent years, we consider that the species of mosquitoes that was previously incriminated as the malaria vector during the outbreak was indeed An. pholidotus, thus ending the controversy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A pseudogene, designated as "ps(5.8S+ITS-2)", paralogous to the 5.8S gene and internal transcribed spacer (ITS)-2 of the nuclear ribosomal DNA (rDNA), has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2)" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2)" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human herpesvirus 6 (HHV-6) may cause severe complications after haematopoietic stem cell transplantation (HSCT). Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR) has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The class Kinetoplastea encompasses both free-living and parasitic species from a wide range of hosts. Several representatives of this group are responsible for severe human diseases and for economic losses in agriculture and livestock. While this group encompasses over 30 genera, most of the available information has been derived from the vertebrate pathogenic genera Leishmaniaand Trypanosoma. Recent studies of the previously neglected groups of Kinetoplastea indicated that the actual diversity is much higher than previously thought. This article discusses the known segment of kinetoplastid diversity and how gene-directed Sanger sequencing and next-generation sequencing methods can help to deepen our knowledge of these interesting protists.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Leptospirosis is a zoonotic disease caused by pathogenic spirochetes of theLeptospira genus. Vaccination with bacterins has severe limitations. Here, we evaluated the N-terminal region of the leptospiral immunoglobulin-like B protein (LigBrep) as a vaccine candidate against leptospirosis using immunisation strategies based on DNA prime-protein boost, DNA vaccine, and subunit vaccine. Upon challenge with a virulent strain ofLeptospira interrogans, the prime-boost and DNA vaccine approaches induced significant protection in hamsters, as well as a specific IgG antibody response and sterilising immunity. Although vaccination with recombinant fragment of LigBrep also produced a strong antibody response, it was not immunoprotective. These results highlight the potential of LigBrep as a candidate antigen for an effective vaccine against leptospirosis and emphasise the use of the DNA prime-protein boost as an important strategy for vaccine development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Studies on natural infection by Leishmania spp of sandflies collected in endemic and nonendemic areas can provide important information on the distribution and intensity of the transmission of these parasites. This study sought to investigate the natural infection by Leishmaniain wild female sandflies. The specimens were caught in the city of Corumbá, state of Mato Grosso do Sul (Brazil) between October 2012-March 2014, and dissected to investigate flagellates and/or submitted to molecular analysis to detect Leishmania DNA. A total of 1,164 females (77.56% of which were Lutzomyia cruzi) representing 11 species were investigated using molecular analysis; 126 specimens of Lu. cruziwere dissected and also submitted to molecular analysis. The infection rate based on the presence of Leishmania DNA considering all the sandfly species analysed was 0.69%; only Leishmania (Leishmania) amazonensis was identified in Lu. cruzi by the molecular analysis. The dissections were negative for flagellates. This is the first record of the presence of L. (L.) amazonensis DNA in Lu. cruzi, and the first record of this parasite in this area. These findings point to the need for further investigation into the possible role of this sandfly as vector of this parasite.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to standardise an in-house real-time polymerase chain reaction (rtPCR) to allow quantification of hepatitis B virus (HBV) DNA in serum or plasma samples, and to compare this method with two commercial assays, the Cobas Amplicor HBV monitor and the Cobas AmpliPrep/Cobas TaqMan HBV test. Samples from 397 patients from the state of São Paulo were analysed by all three methods. Fifty-two samples were from patients who were human immunodeficiency virus and hepatitis C virus positive, but HBV negative. Genotypes were characterised, and the viral load was measure in each sample. The in-house rtPCR showed an excellent success rate compared with commercial tests; inter-assay and intra-assay coefficients correlated with commercial tests (r = 0.96 and r = 0.913, p < 0.001) and the in-house test showed no genotype-dependent differences in detection and quantification rates. The in-house assay tested in this study could be used for screening and quantifying HBV DNA in order to monitor patients during therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Triatoma sordida is a species that transmits Trypanosoma cruzi to humans. In Brazil, T. sordida currently deserves special attention because of its wide distribution, tendency to invade domestic environments and vectorial competence. For the planning and execution of control protocols to be effective against Triatominae, they must consider its population structure. In this context, this study aimed to characterise the genetic variability of T. sordida populations collected in areas with persistent infestations from Minas Gerais, Brazil. Levels of genetic variation and population structure were determined in peridomestic T. sordida by sequencing a polymorphic region of the mitochondrial cytochrome b gene. Low nucleotide and haplotype diversity were observed for all 14 sampled areas; π values ranged from 0.002-0.006. Most obtained haplotypes occurred at low frequencies, and some were exclusive to only one of the studied populations. Interpopulation genetic diversity analysis revealed strong genetic structuring. Furthermore, the genetic variability of Brazilian populations is small compared to that of Argentinean and Bolivian specimens. The possible factors related to the reduced genetic variability and strong genetic structuring obtained for studied populations are discussed in this paper.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Heterobathmia pseuderiocrania Kristensen & Nielsen (Lepidoptera, Heterobathmiidae): identification based on DNA-barcoding and notes on the morphology and life history of the immature stages. The larva morphology of the species Heterobathmia pseuderiocrania (Lepidoptera, Heterobathmiidae), a Nothofagus obliqua leafminer in Chile, is described. The tissue-feeding first and last instars are described. Also, the number of larval stages, some aspects of the biology and life cycle of the species are provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.