82 resultados para skin conductance response
Resumo:
The aim of the present study was to determine whether specific subgroups of schizophrenic patients, grouped according to electrodermal characteristics, show differences in the N-acetylaspartate/creatine plus choline (NAA / (Cr + Cho)) ratios in the frontal, cingulate and perirolandic cortices. Skin conductance levels (SCL) and skin conductance responses to auditory stimulation were measured in 38 patients with schizophrenia and in the same number of matched healthy volunteers (control). All subjects were submitted to multivoxel proton magnetic resonance spectroscopic imaging. When compared to the control group, patients presented significantly lower NAA / (Cr + Cho) ratios in the right dorsolateral prefrontal cortex (schizophrenia = 0.95 ± 0.03; control = 1.12 ± 0.04) and in the right (schizophrenia = 0.88 ± 0.02; control = 0.94 ± 0.03) and left (schizophrenia = 0.84 ± 0.03; control = 0.94 ± 0.03) cingulates. These ratios did not differ between electrodermally responsive and non-responsive patients. When patients were divided into two groups: lower SCL (less than the mean SCL of the control group minus two standard deviations) and normal SCL (similar to the control group), the subgroup with a lower level of SCL showed a lower NAA / (Cr + Cho) ratio in the left cingulate (0.78 ± 0.05) than the controls (0.95 ± 0.02, P < 0.05) and the subgroup with normal SCL (0.88 ± 0.03, P < 0.05). There was a negative correlation between the NAA / (Cr + Cho) ratio in the left cingulate of patients with schizophrenia and the duration of the disease and years under medication. These data suggest the existence of a schizophrenic subgroup characterized by low SCL that could be a consequence of the lower neuronal viability observed in the left cingulate of these patients.
Resumo:
This review covers the effect of drugs affecting anxiety using four psychological procedures for inducing experimental anxiety applied to healthy volunteers and patients with anxiety disorders. The first is aversive conditioning of the skin conductance responses to tones. The second is simulated public speaking, which consists of speaking in front of a video camera, with anxiety being measured with psychometric scales. The third is the Stroop Color-Word test, in which words naming colors are painted in the same or in a different shade, the incongruence generating a cognitive conflict. The last test is a human version of a thoroughly studied animal model of anxiety, fear-potentiated startle, in which the eye-blink reflex to a loud noise is recorded. The evidence reviewed led to the conclusion that the aversive conditioning and potentiated startle tests are based on classical conditioning of anticipatory anxiety. Their sensitivity to benzodiazepine anxiolytics suggests that these models generate an emotional state related to generalized anxiety disorder. On the other hand, the increase in anxiety determined by simulated public speaking is resistant to benzodiazepines and sensitive to drugs affecting serotonergic neurotransmission. This pharmacological profile, together with epidemiological evidence indicating its widespread prevalence, suggests that the emotional state generated by public speaking represents a species-specific response that may be related to social phobia and panic disorder. Because of scant pharmacological data, the status of the Stroop Color-Word test remains uncertain. In spite of ethical and economic constraints, human experimental anxiety constitutes a valuable tool for the study of the pathophysiology of anxiety disorders.
Resumo:
In this study, we report on the safety and skin delayed-type hypersensitivity (DTH), responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG), Montanide ISA 720 (MISA) or Monophosphoryl lipid A (MPLA) in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) levels were also measured and these were compared with DTH. Only those animals immunized with alum-BCG reacted adversely to the inoculum by producing ulcerative erythematous skin indurations. Non-parametric analysis of variance followed by a post-test showed significantly higher DTH responses in the MISA+Ag group compared with other immunized groups (p < 0.001). The MPLA+Ag group indicated significantly lower DTH responses to the sonicate antigen compared with the AlBCG+Ag group. There was a significant correlation between the DTH and cytokine responses (p < 0.0001). Based on this study we conclude that Leishmania donovani sonicate antigen containing MISA 720 is safe and is associated with a strong DTH reaction following immunization.
Resumo:
We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients), and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients). Prevalence of bacteria isolated by culture methods was 90.9% (10/11). We cultured, from chiclero's ulcers (60%), pathogenic bacterial such as Staphylococcus aureus (20%), S. pyogenes (1.6%), Pseudomonas aeruginosa (1.6%), Morganella morganii (1.6%), and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%), Enterobacter spp. (20%), and Enterococcus spp. (20%). We also cultured coagulase-negative staphylococci in 40% (4/10) of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15) of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L.) mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.
Resumo:
The relationship between the irritable bowel syndrome (IBS) and food intolerance is not clear. We studied the cutaneous response to food antigens in 43 volunteers who were students and employees of the Faculty of Medicine of Universidade Federal Fluminense. Subjects were divided into 3 groups after evaluation for Roma II criteria for functional disease of the gastrointestinal tract: group I, 14 volunteers with IBS; group II, 15 volunteers with functional dyspepsia; group III, 14 volunteers without habitual gastrointestinal symptoms. The subjects were submitted to the skin prick test with 9 food antigen extracts, for a total of 387 skin tests (9 per volunteer). Of the 126 tests applied to group I, 24 (19.4%) were positive (a 3-mm wider papule than the negative control) and of the 135 tests applied to group II, 3 (2.3%) were positive. Of the 126 tests applied to group III, 6 (4%) were positive. The number of positive responses obtained in group I (IBS) differed significantly from the other 2 groups (P < 0.01). None of the volunteers with IBS reported intolerance to any isolated food. The higher reactivity to food antigens in group I compared to groups II and III suggests that intestinal permeability may be increased in patients with IBS.
Resumo:
The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR) was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS) involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9). The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%), axonal sensorimotor polyneuropathy in 2 (3.3%), and carpal tunnel syndrome in 6 (10%). SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3%) reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.
Resumo:
Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The interaction between specific immune response to Schistosoma mansoni and praziquantel (PZQ) was studied in mice. In mice harboring concomitant immunity, 6-day-old parasites treated with PZQ were more effectively removed than 24h treated parasites despite both had a significant worm burden reduction when compared with respective treated controls. These results show that PZQ can be effective at the skin and lung stages of parasite's development mainly acting with a established specific immune response, and particularly at the lung phase.
Resumo:
American tegumentary leishmaniasis presents as two major clinical forms: localized cutaneous leishmaniasis (LCL) and mucocutaneous leishmaniasis (MCL). The immune response in leishmaniasis is efficiently evaluated by the response to Leishmania antigen through the Montenegro skin test (MST). Both LCL and MCL present positive response to MST, indicating that the patients present cell-mediated immunity against the parasite - Leishmania. In spite of the presence of immunity in MCL, this is not sufficient to stop disease progression and prevent resistance to treatment. In this study we demonstrated interleukin (IL) 2, 4, 5 and interferon (IFN) gamma expression in biopsies of MST of ten patients with American tegumentary leishmaniasis. The obtained results were compared between LCL (n = 5) and MCL (n = 5) patients. The MST of MCL patients displayed a higher expression of IL-2, IL-4 and IL-5, in comparison to LCL. There was no significant difference in IFN-gamma expression between groups. The obtained results suggest the role of IL-4 and IL-5 in the maintenance of the immunopathogenic mechanism of the destructive lesions that characterize MCL.
Resumo:
Spleen cells from mice were examined at 5, 10, 15, 20 and 25 days post-infection (dpi) with Dermatobia hominis larva and at 5, 10, 15, 30 and 60 days post-larval emergence (dple). Cell proliferation in vitro assays were carried out with RPMI-1640 medium and larval secretory product (LSP) of D. hominis at 5, 10, 15, 20 and 25 days. When each group of mice was tested against each medium, significance was only seen for 25 dpi, with increasing order: LSP-10 d, -25 d, -5 d, -20 d, -15 d and RPMI. Significant results were also observed when each medium was tested against mice at each dpi or dple. Each dple group vs. each medium produced significant results only for 10 dple, with increasing order: LSP-5 d, -20 d, -25 d, -10 d, -15 d and RPMI. Comparative tests were also carried out between groups to refine certain observations. The LSPs were also analyzed using SDS-PAGE. The results prove that myiasis caused depletion of spleen cells, particularly under the effect of the LSP-10 and -15, but the cells tended to increase up to 60 dple. This in vitro assay may represent the real systemic immune response in the relationship LSP-D. hominis-host.
Resumo:
A case-control study was conducted to examine the association among the Montenegro skin test (MST), age of skin lesion and therapeutic response in patients with cutaneous leishmaniasis (CL) treated at Evandro Chagas National Institute of Infectious Diseases (INI), Oswaldo Cruz Foundation (FIOCRUZ), Rio de Janeiro, Brazil. For each treatment failure (case), two controls showing skin lesion healing following treatment, paired by sex and age, were randomly selected. All patients were treated with 5 mg Sb5+/kg/day of intramuscular meglumine antimoniate (Sb5+) for 30 successive days. Patients with CL were approximately five times more likely to fail when lesions were less than two months old at the first appointment. Patients with treatment failure showed less intense MST reactions than patients progressing to clinical cure. For each 10 mm of increase in MST response, there was a 26% reduction in the chance of treatment failure. An early treatment - defined as a treatment applied for skin lesions, which starts when they are less than two months old at the first appointment -, as well as a poor cellular immune response, reflected by lower reactivity in MST, were associated with treatment failure in cutaneous leishmaniasis.
Resumo:
The clinical manifestations and prognosis of cutaneous leishmaniasis (CL) can be influenced by the immune response of the patient and the species of the parasite. A case of atypical clinical presentation of CL, with development of non-characteristic lesions, poor response to therapy, and a long time to resolution is reported. Confirmatory laboratory tests included parasite detection, indirect immunofluorescence, Montenegro skin test, polymerase chain reaction, and parasite identification by multilocus enzyme electrophoresis. The parasite was identified as Leishmaniabraziliensis. The lesion was unresponsive to three complete courses of N-methylglucamine antimoniate intramuscular, and to treatment with pentamidine. The patient did not tolerate amphotericin B. The lesion finally receded after treatment with intravenous N-methylglucamine antimoniate. It is essential to ensure the accuracy of diagnosis and the appropriate treatment, which can include the use a second choice drug or a different route of administration.
Resumo:
The authors report a case of diffuse cutaneous leishmaniasis, with longstanding evolution and presenting with diffuse infiltrated lesions rich in amastigotes in the absence of mucosal involvement. In situ characterization with monoclonal antibodies revealed Leishmania amazonensis. Large regional lesions have presented spontaneous healing without specific therapy. Considering that DCL presents with a defect in the cellular immune response, thisfact demonstrate that this patient may develop a regional cellular immune response enough to destroy the parasites and to produce clearing of some lesions.
Resumo:
We report on the measurement of saliva anti-Purified Protein Derivative sIgA and 38kDa antibodies from 127 children, of whom 31 were strong tuberculosis suspects and 96 were healthy contact children. The results concerning the percentage of children with antibody reactivity to PPD and 38kDa antigens showed that, of these 2 antigens, 38kDa induced higher reactivity in patients positive and negative for the Tuberculin Skin Test (28% and 16.6%, respectively) in comparison to controls positive and negative for the TST (11.7% and 7.1%, respectively). There was a statistically significant difference between patients positive and controls negative for the TST. In relation to the Purified Protein Derivative antigen, while 14.2% of patients positive for the TST showed antibody reactivity to the PPD antigen, no patients negative for the TST had reactivity to this antigen. The findings suggest that these two antigens seem be associated with a different development of the mucosal defence mechanisms mediated by sIgA against Mycobacterium tuberculosis.