16 resultados para barrier integrity


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Chronic inflammation induced by amyloid-beta (Aβ) plays a key role in the development of age-related macular degeneration (AMD), and matrix metalloproteinase-9 (MMP-9), interleukin (IL)-6, and IL-8 may be associated with chronic inflammation in AMD. Sirtuin 1 (SIRT1) regulates inflammation via inhibition of nuclear factor-kappa B (NF-κB) signaling, and resveratrol has been reported to prevent Aβ-induced retinal degeneration; therefore, we investigated whether this action was mediated via activation of SIRT1 signaling. Human adult retinal pigment epithelial (RPE) cells were exposed to Aβ, and overactivation and knockdown of SIRT1 were performed to investigate whether SIRT1 is required for abrogating Aβ-induced inflammation. We found that Aβ-induced RPE barrier disruption and expression of IL-6, IL-8, and MMP-9 were abrogated by the SIRT1 activator SRT1720, whereas alterations induced by Aβ in SIRT1-silenced RPE cells were not attenuated by SRT1720. In addition, SRT1720 inhibited Aβ-mediated NF-κB activation and decrease of the NF-κB inhibitor, IκBα. Our findings suggest a protective role for SIRT1 signaling in Aβ-dependent retinal degeneration and inflammation in AMD.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The geriatric depression (GD) represents one of the most frequent psychiatric disorders in outpatient services specialized in old-age treatment. OBJECTIVE: The course of two illustrative cases of GD is discussed, highlighting its clinical picture after antidepressant treatment and underlining variables related to disease prognosis, treatment effectiveness and conversion to major cognitive disorders such as vascular dementia (VD). METHODS: The cognitive performance, depressive symptoms, autonomy and brain structural measurements as white matter hyperintensities (WMH) and hippocampal size, and microstructural integrity of WM with diffusion tensor imaging were followed during four years. RESULTS: Case 1, with a severe degree of WMH, was associated with worsening cognition and increasing functional disability. Case 2, with mild WMH, an improvement of cognitive functioning could be seen. CONCLUSIONS: The existence of different subtypes of GD, as presented in this report, points a pathophysiological heterogeneity of GD, and suggests a possible continuum vascular depression (VaDp) and vascular cognitive impairment (VCI).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Many studies demonstrate that intestinal inflammation is either initiated or exaggerated by a component of the normal microbiota, most likely commensal bacteria or products derived from these organisms. We review the nature of human inflammatory bowel disease, the evidence for the involvement of the normal bacterial flora in these disorders and the relevance of maintaining the integrity of the epithelial barrier. Moreover, we, and others, have shown abnormal mitochondria structure in tissue resections from patients with inflammatory bowel disease and tissues from rodents that demonstrated psychological stress-induced increases in epithelial permeability. Thus, we also consider the possibility that a defect in epithelial mitochondrial function would predispose an individual to respond to their commensal bacteria flora - no longer considering them as a beneficial passive inhabitant, but rather perceiving them as a threatening and pro-inflammatory stimulus. In support of this postulate, we discuss our recent findings from an in vitro model showing that the human colon-derived T84 cell line exposed to the metabolic stressor, dinitrophenol, and the non-pathogenic, non-invasive, Escherichia coli (strain HB101) display a loss of barrier function, increased signal transduction and increased production of the chemokine, interleukin 8.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An unusually high incidence of microcephaly in newborns has recently been observed in Brazil. There is a temporal association between the increase in cases of microcephaly and the Zika virus (ZIKV) epidemic. Viral RNA has been detected in amniotic fluid samples, placental tissues and newborn and fetal brain tissues. However, much remains to be determined concerning the association between ZIKV infection and fetal malformations. In this study, we provide evidence of the transplacental transmission of ZIKV through the detection of viral proteins and viral RNA in placental tissue samples from expectant mothers infected at different stages of gestation. We observed chronic placentitis (TORCH type) with viral protein detection by immunohistochemistry in Hofbauer cells and some histiocytes in the intervillous spaces. We also demonstrated the neurotropism of the virus via the detection of viral proteins in glial cells and in some endothelial cells and the observation of scattered foci of microcalcifications in the brain tissues. Lesions were mainly located in the white matter. ZIKV RNA was also detected in these tissues by real-time-polymerase chain reaction. We believe that these findings will contribute to the body of knowledge of the mechanisms of ZIKV transmission, interactions between the virus and host cells and viral tropism.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Acid mine drainage (AMD) is an environmental concern due to the risk of element mobilization, including toxic elements, and inclusion in the food chain. In this study, three cover layers were tested to minimize As, Fe and S mobilization from a substrate from former gold mining, containing pyrite and arsenopyrite. For this purpose, different layers (capillary break, sealant and cover layer) above the substrate and the induction of a geochemical barrier (GB) were used to provide suitable conditions for adsorption and co-precipitation of the mobilized As. Thirteen treatments were established to evaluate the leaching of As, Fe and S from a substrate in lysimeters. The pH, As, Fe, S, Na, and K concentrations and total volume of the leachates were determined. Mineralogical analyses were realized in the substrate at the end of the experimental period. Lowest amounts of As, Fe and S (average values of 5.47, 48.59 and 132.89 g/lysimeter) were leached in the treatments that received Na and K to induce GB formation. Mineralogical analyses indicated jarosite formation in the control treatment and in treatments that received Na and K salts. However, the jarosite amounts in these treatments were higher than in the control, suggesting that these salts accelerated the GB formation. High amounts of As, Fe and S (average values of 11.7, 103.94 and 201.13 g/lysimeter) were observed in the leachate from treatments without capillary break layer. The formation of geochemical barrier and the use of different layers over the sulfide substrate proved to be efficient techniques to decrease As, Fe and S mobilization and mitigate the impact of acid mine drainage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este trabalho foi realizado com o objetivo de estabelecer a melhor concentração de sais do meio MS e da citocinina BAP para a multiplicação dos porta-enxertos de Prunus sp. 'Barrier' e 'Cadaman'. Segmentos nodais foram introduzidos em tubos de ensaio contendo 10 mL de meio de cultura com variações na concentração de sais (MS; ½MS; e 2/3MS) combinadas com cinco concentrações de BAP (0; 1,5; 2,5; 3,5 e 4,5 miM). Utilizou-se um fatorial 2x3x5, distribuído em blocos casualizados, compostos por quatro repetições contendo cinco tubos de ensaio cada uma, sendo inoculado um segmento nodal por tubo. As avaliações foram realizadas após cinco semanas de cultivo em ambiente com intensidade luminosa de 20 miE m-2 s-1, fotoperíodo de 16 horas e temperatura de 24 ± 4ºC. Verificou-se maior número médio de gemas e de brotações para a cultivar Barrier. À medida que se reduziu a concentração de sais do meio de cultura, obteve-se maior número de brotações, porém com menor tamanho. As regressões polinomiais das variáveis número de gemas, brotações por explante e comprimento das brotações apresentaram um ajustamento quadrático para níveis de BAP, atingindo os pontos de máximo 31,2 gemas/explante; 4,6 brotações por explante, e 8,1 mm de comprimento nas concentrações 3,3; 3,1, e 3,1 miM de BAP, respectivamente.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Alpha-Hemolysin is synthesized as a 1024-amino acid polypeptide, then intracellularly activated by specific fatty acylation. A second activation step takes place in the extracellular medium through binding of Ca2+ ions. Even in the absence of fatty acids and Ca2+ HlyA is an amphipathic protein, with a tendency to self-aggregation. However, Ca2+-binding appears to expose hydrophobic patches on the protein surface, facilitating both self-aggregation and irreversible insertion into membranes. The protein may somehow bind membranes in the absence of divalent cations, but only when Ca2+ (or Sr2+, or Ba2+) is bound to the toxin in aqueous suspensions, i.e., prior to its interaction with bilayers, can a-hemolysin bind irreversibly model or cell membranes in such a way that the integrity of the membrane barrier is lost, and cell or vesicle leakage ensues. Leakage is not due to the formation of proteinaceous pores, but rather to the transient disruption of the bilayer, due to the protein insertion into the outer membrane monolayer, and subsequent perturbations in the bilayer lateral tension. Protein or glycoprotein receptors for a-hemolysin may exist on the cell surface, but the toxin is also active on pure lipid bilayers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to assess the desiccation tolerance and DNA integrity in Eugenia pleurantha seeds dehydrated to different moisture contents (MCs). Seeds extracted from mature fruits were submmited to drying in silica gel and evaluated at every five percentual points of decrease from the initial MC (35.5%, fresh weight basis). The effects of dehydration on seeds were verified through germination tests and DNA integrity assessment. Undried seeds achieved 87% germination, value reduced to 36% after being dried to 9.8% MC. When dried slightly more, to 7.4% MC, seeds were no longer able to germinate, suggesting an intermediate behavior in relation to desiccation tolerance. It was observed DNA degradation in seeds with 7.4% MC, which might have contributed to the loss of seed germination.