38 resultados para Test structure
Resumo:
This paper concerns the development of drives that use electromechanical rotative motor systems. It is proposed an experimental drive test structure integrated to simulation softwares. The objective of this work is to show that an affordable model validation procedure can be obtained by combining a precision data acquisition with well tuned state-of-the-art simulation packages. This is required for fitting, in the best way, a drive to its load or, inversely, to adapt loads to given drive characteristics.
Resumo:
Construction of hydroelectric dams in tropical regions has been contributing significantly to forest fragmentation. Alterations at edges of forest fragments impact plant communities that suffer increases in tree damage and dead, and decreases in seedling recruitment. This study aimed to test the core-area model in a fragmented landscape caused by construction of a hydroelectric power plant in the Brazilian Amazon. We studied variations in forest structure between the margin and interiors of 17 islands of 8-100 hectares in the Tucuruí dam reservoir, in two plots (30 and >100m from the margin) per island. Mean tree density, basal area, seedling density and forest cover did not significantly differ between marginal and interior island plots. Also, no significant differences were found in liana density, dead tree or damage for margin and interior plots. The peculiar topographic conditions associated with the matrix habitat and shapes of the island seem to extend edge effects to the islands' centers independently of the island size, giving the interior similar physical microclimatic conditions as at the edges. We propose a protocol for assessing the ecological impacts of edge effects in fragments of natural habitat surrounded by induced (artificial) edges. The protocol involves three steps: (1) identification of focal taxa of particular conservation or management interest, (2) measurement of an "edge function" that describes the response of these taxa to induced edges, and (3) use of a "Core-Area Model" to extrapolate edge function parameters to existing or novel situations.
Resumo:
The taxonomic composition, observed and estimated species richness, and patterns of community structure of arboreal spider assemblages in eleven sites surrounding the "Banhado Grande" wet plain in the state of Rio Grande do Sul, Brazil, are presented. These sites represent three different vegetational types: hillside (four sites), riparian (five sites) and flooded forests (two sites). The spiders were captured by beating on foliage and "aerial litter". A sample was defined as the result of beating on twenty bushes, tree branches or "aerial litter" clusters, which roughly corresponds to one-hour search effort per sample. Fifty five samples (five per site) were obtained, resulting in an observed richness of 212 species present as adult or identifiable juveniles. The total richness for all samples was estimated to be between 250 (Bootstrap) to 354 species (Jackknife 2). Confidence intervals of both sample and individual-based rarefaction curves for each vegetation type clearly indicated that flooded forest is the poorest vegetation type with respect to spider species richness, with hillside and riparian forests having a similar number of species. The percentage complementarity between the eleven sites indicated that all sites contain a distinct set of species, irrespective of their vegetation types. Nevertheless, the spider assemblages in riparian and hillside forests are more similar with respect to each other than when compared to flooded forest. Both cluster and nonmetric multidimensional scaling analyses showed no strong correspondence between the spider arboreal fauna and the three vegetation types. Moreover, a Mantel test revealed no significant association between species composition and geographic distance among sites.
Resumo:
Patterns of parasite abundance and prevalence are thought to be influenced by several host characteristics such as size, sex, developmental stage, and seasonality. We examined two obligatory ectoparasites of the bat Noctilio leporinus (L.) (Chiroptera, Noctilionidae) to test whether prevalence and abundance of Noctiliostrebla aitkeni Wenzel and Paradyschiria fusca Speiser (Diptera, Streblidae) are influenced by the host characteristics. During this survey, 2110 flies were collected. The total abundance was 1150 N. aitkeni and 950 P. fusca. The prevalence of both species was shown to be superior to 75% and neither host size, sex, reproductive stage nor season influenced significantly the variation of the observed values. N. aitkeni were more abundant than P. fusca in all seasons except winter. Both flies showed a significant seasonal variation in terms of abundance but host biological characteristics (host size, sex, and reproductive stage) did not play a significant role as structuring factors of the batflies component community.
Resumo:
Fifty-five clinical and environmental Aspergillus fumigatus isolates from Mexico, Argentina, France and Peru were analyzed to determine their genetic variability, reproductive system and level of differentiation using amplified fragment length polymorphism markers. The level of genetic variability was assessed by measuring the percentage of polymorphic loci, number of effective alleles, expected heterozygocity and by performing an association index test (I A). The degree of genetic differentiation and variation was determined using analysis of molecular variance at three levels. Using the paired genetic distances, a dendrogram was built to detect the genetic relationship among alleles. Finally, a network of haplotypes was constructed to determine the geographic relationship among them. The results indicate that the clinical isolates have greater genetic variability than the environmental isolates. The I A of the clinical and environmental isolates suggests a recombining population structure. The genetic differentiation among isolates and the dendrogram suggest that the groups of isolates are different. The network of haplotypes demonstrates that the majority of the isolates are grouped according to geographic origin.
Resumo:
To evaluate whether environmental heterogeneity contributes to the genetic heterogeneity in Anopheles triannulatus, larval habitat characteristics across the Brazilian states of Roraima and Pará and genetic sequences were examined. A comparison with Anopheles goeldii was utilised to determine whether high genetic diversity was unique to An. triannulatus. Student t test and analysis of variance found no differences in habitat characteristics between the species. Analysis of population structure of An. triannulatus and An. goeldii revealed distinct demographic histories in a largely overlapping geographic range. Cytochrome oxidase I sequence parsimony networks found geographic clustering for both species; however nuclear marker networks depicted An. triannulatus with a more complex history of fragmentation, secondary contact and recent divergence. Evidence of Pleistocene expansions suggests both species are more likely to be genetically structured by geographic and ecological barriers than demography. We hypothesise that niche partitioning is a driving force for diversity, particularly in An. triannulatus.
Effects of forest conversion on the assemblages' structure of aquatic insects in subtropical regions
Resumo:
The effects of forest conversion to agricultural land uses on assemblages of aquatic insects were analyzed in subtropical streams. Organisms and environmental variables were collected in six low-order streams: three streams located in a forested area, and three in areas converted to agricultural land uses. We expected that the aquatic insects' assemblage attributes would be significantly affected by forest conversion, as well as by environmental variables. Streams in converted areas presented lower species richness, abundance and proportion of sensitive insect taxa. The ANOSIM test evidenced strong difference in EPT assemblage structure between streams of forested and converted areas. The ISA test evidenced several EPT genera with high specificity to streams in forested areas and only one genus related to streams in converted areas. Thus, the impacts of the conversion of forested area to agricultural land uses have significantly affected the EPT assemblages, while environmental variables were not affected. We suggest that the effects detected can be influenced by two processes related to vegetation cover: i) lower input of allochthonous material, and ii) increased input of fine sediments in streams draining converted areas.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Hancornia speciosa Gomes is a fruit tree native from Brazil that belongs to Apocinaceae family, and is popularly known as Mangabeira. Its fruits are widely consumed raw or processed as fruit jam, juices and ice creams, which have made it a target of intense exploitation. The extractive activities and intense human activity on the environment of natural occurrence of H. speciosa has caused genetic erosion in the species and little is known about the ecology or genetic structure of natural populations. The objective of this research was the evaluation of the genetic diversity and genetic structure of H. speciosa var. speciosa. The genetic variability was assessed using 11 allozyme loci with a sample of 164 individuals distributed in six natural populations located in the States of Pernambuco and Alagoas, Northeastern Brazil. The results showed a high level of genetic diversity within the species (e= 0.36) seeing that the most of the genetic variability of H. speciosa var. speciosa is within its natural populations with low difference among populations (
or = 0.081). The inbreeding values within (
= -0.555) and among populations (
=-0.428) were low showing lacking of endogamy and a surplus of heterozygotes. The estimated gene flow (
m ) was high, ranging from 2.20 to 13.18, indicating to be enough to prevent the effects of genetic drift and genetic differentiation among populations. The multivariate analyses indicated that there is a relationship between genetic and geographical distances, which was confirmed by a spatial pattern analysis using Mantel test (r = 0.3598; p = 0.0920) with 1000 random permutations. The high genetic diversity index in these populations indicates potential for in situ genetic conservation.
Resumo:
The void structure of zeolites MCM-22, MCM-36 and ITQ-2 were discussed on the bases of catalytic reaction tests. The hydromerization of n-decane on bifunctional Pt/Zeolite Catalysts have been used as model reactions. Beta and ZSM-5 zeolites were used for comparison. It is concluded that all materials show features of 10MR zeolites and have also pores bigger than 12MR in this order MCM-22
Resumo:
Genetic algorithm and multiple linear regression (GA-MLR), partial least square (GA-PLS), kernel PLS (GA-KPLS) and Levenberg-Marquardt artificial neural network (L-M ANN) techniques were used to investigate the correlation between retention index (RI) and descriptors for 116 diverse compounds in essential oils of six Stachys species. The correlation coefficient LGO-CV (Q²) between experimental and predicted RI for test set by GA-MLR, GA-PLS, GA-KPLS and L-M ANN was 0.886, 0.912, 0.937 and 0.964, respectively. This is the first research on the QSRR of the essential oil compounds against the RI using the GA-KPLS and L-M ANN.
Resumo:
ABSTRACTThis study aimed to analyze the vertical and diameter structure and the spatial distribution pattern of Bauhinia cheilantha in two Caatinga fragments in Sergipe, Brazil, at different regeneration stages. Thirty plots were demarcated in area I (Canindé de São Francisco and Poço Redondo), which has vegetation regeneration, and 25 plots in area II (Porto da Folha) with preserved vegetation, both having 400 m2. All B. cheilanthaindividuals had their height and circumference (circumference at breast height > 6 cm) measured. Possible differences in height and diameter at breast height were tested in the two populations by using Student’s T-test. The distribution pattern of species was calculated through Payandeh’s index. We sampled 154 B. cheilantha individuals, equivalent to 33.3% of the plots in area I and in 1,027 individuals in area II, totaling 100% frequency. Height and the diameter of the two populations were statistically different, where AI achieved all values lower than AII. The spatial distribution pattern of B. cheilantha found in both areas was aggregate, with values of 11.85 and 9.00, respectively. Thus, it became clear that the population in AII is at a more advanced successional status than AI, due to its longer conservation time.
Resumo:
Maize is a C4 plant that shows few or no response to high [CO2]. Thus, this study aimed to analyze the photosynthetic rate and yield of maize under high [CO2] and develop open-top chambers (OTC) to create an atmosphere enriched with CO2. The experiment was conducted between October 2008 and March 2009. The OTCs were developed in modular scheme. Measurement of photosynthetic rates, transpiration, stomata conductance, grain yield and dry matter were performed. The experimental design was randomized blocks with four replications and three treatments: P1 - plants grown in OTC with 700 ppm [CO2], P2 - plants grown in OTC with environmental [CO2], and P3 - control, cultivated in open field. The results were analyzed by ANOVA and Tukey's test (Pr< 0.05). The chambers can reduce by 25% the photosynthetically active radiation and increase the air and leaf temperatures. Plants under high [CO2] (P1) showed the highest photosynthetic rates and the lowest stomata conductance and transpiration. The total weight of grains (g) and dry mass of shoots (g) showed no increases for P1, despite their higher photosynthetic rates.
Resumo:
This study aimed to describe the probabilistic structure of the annual series of extreme daily rainfall (Preabs), available from the weather station of Ubatuba, State of São Paulo, Brazil (1935-2009), by using the general distribution of extreme value (GEV). The autocorrelation function, the Mann-Kendall test, and the wavelet analysis were used in order to evaluate the presence of serial correlations, trends, and periodical components. Considering the results obtained using these three statistical methods, it was possible to assume the hypothesis that this temporal series is free from persistence, trends, and periodicals components. Based on quantitative and qualitative adhesion tests, it was found that the GEV may be used in order to quantify the probabilities of the Preabs data. The best results of GEV were obtained when the parameters of this function were estimated using the method of maximum likelihood. The method of L-moments has also shown satisfactory results.
Resumo:
Weeds in pastures can intoxicate animals, and Arrabidaea bilabiata is the most important species for herbivores in floodplain areas in the Amazon Basin. Genetic diversity studies in natural populations may contribute to the better understanding of the range of toxicity and the genetic variability organization in this species. The objective of this study was to assess the variability and genetic structure in six populations of A. bilabiata sampled in floodplain areas in three municipalities of the Amazonas State, from the AFLP markers analysis. AFLP markers were efficient to characterize the genetic variability of the 65 individuals analyzed. From four combinations of oligonucleotides, a total of 309 AFLP fragments was obtained, where 304 (98.38%) were polymorphic. By the dendrogram and Bayesian cluster analysis, there was a formation of two isolated groups, the first one comprising individuals from Autazes municipality and the second one comprising individuals from Itacoatiara and Parintins. However, depending on the method to define the most probable cluster number, there was a separation of the six populations, according to their geographical origin. Mantel test confirmed that geographically closer populations are more akin, although low gene flow (0.538) is observed among the sampled populations. The molecular analysis of variance found that 49.29% of the genetic variability are among individuals inside populations and 50.71% among the populations analyzed. The results indicate the possibility that isolated A. bilabiata populations contain plants with different toxicity levels and suggest a strong adaptability of the species.