66 resultados para TH2 CELLS


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Evidence is accumulating that Th1 cells play an important role in the development of multiple sclerosis (MS) and experimental allergic encephalomyelitis (EAE), whereas Th2 cells contribute to recovery from disease. A major determinant in the development of Th1 and Th2 cells is the type of antigen-presenting cell (APC) involved and its functional characteristics, e.g., the production of interleukin-12. Therefore, modulation of APC might interfere with the development of Th1 type responses and as such be beneficial for MS and EAE. The potential of cytokines, in particular interleukin-10, and glucocorticoids to exert a selective effect on APC, and as a consequence to affect the Th1-Th2 balance in EAE, is discussed

Relevância:

60.00% 60.00%

Publicador:

Resumo:

INTRODUCTION: Ascaris lumbricoides-infected patients present lower prevalence of severe atopic dermatitis. METHODS: Peripheral blood of infected children with atopic dermatitis was assessed by flow cytometry of the frequency of Th1 and Th2 cells through the expression of CXCR3 and CCR4 chemokine receptors, respectively. RESULTS: Helminth-free patients with atopic dermatitis presented a high frequency of CCR4+Th2 cells. Parasitized patients with atopic dermatitis showed a lower frequency of CXCR3+Th1 cells compared to infected individuals only. CONCLUSIONS: Ascariasis modifies the blood traffic of Th2 cells in atopic dermatitis patients, while the allergic disease down-regulates the traffic of Th1 cells in parasitized patients.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Allergic diseases have been closely related to Th2 immune responses, which are characterized by high levels of interleukin (IL) IL-4, IL-5, IL-9 and IL-13. These cytokines orchestrate the recruitment and activation of different effector cells, such as eosinophils and mast cells. These cells along with Th2 cytokines are key players on the development of chronic allergic inflammatory disorders, usually characterized by airway hyperresponsiveness, reversible airway obstruction, and airway inflammation. Accumulating evidences have shown that altering cytokine-producing profile of Th2 cells by inducing Th1 responses may be protective against Th2-related diseases such as asthma and allergy. Interferon-gamma (IFN-gamma), the principal Th1 effector cytokine, has shown to be crucial for the resolution of allergic-related immunopathologies. In fact, reduced production of this cytokine has been correlated with severe asthma. In this review, we will discuss the role of IFN-gamma during the generation of immune responses and its influence on allergic inflammation models, emphasizing its biologic properties during the different aspects of allergic responses.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The immune response to pathogens results in both host resistance and immunopathology. Cytokines and in particular those lymphokines produced by Th1 and Th2 cells play a key role in determining the balance between these two immunologic outcomes. Recent data suggest that interleukin-10, a product of both Th2 cells and macrophages, protects the host against excessive immunopathology. The cytokine environment generated by different pathogens may also influence the course and outcome of infections with unrelated organisms. This relationship may be particularly important in the case of HIV-1 where prior Th1 or Th2 biases established by helminth or intracellular infections may influence either initial viral susceptibility or drive progression to AIDS through immune activation

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Activation of Th1 or Th2 cells is associated with production of specific immunoglobulin isotypes, offering the opportunity to use antibody measurement for evaluation of T cell function. Schistosomiasis and visceral leishmaniasis are diseases associated with Th2 activation. However, an IgE response is not always detected in these patients. In the present study we evaluated specific IgE antibodies to S. mansoni and L. chagasi antigens by ELISA after depletion of serum IgG with protein G immobilized on Sepharose beads or RF-absorbent (purified sheep IgG antibodies anti-human IgG). In schistosomiasis patients, specific IgE to SWAP antigen was demonstrable in only 10 of 21 patients (48%) (mean absorbance ± SD = 0.102 ± 0.195) when unabsorbed serum was used. Depletion of IgG with protein G increased the number of specific IgE-positive tests to 13 (62%) and the use of RF-absorbent increased the number of positive results to 20 (95%) (mean absorbances ± SD = 0.303 ± 0.455 and 0.374 ± 0.477, respectively). Specific IgE anti-L. chagasi antibodies were not detected in unabsorbed serum from visceral leishmaniasis patients. When IgG was depleted with protein G, IgE antibodies were detected in only 3 (11%) of 27 patients, and the use of RF-absorbent permitted the detection of this isotype in all 27 visceral leishmaniasis sera tested (mean absorbance ± SD = 0.104 ± 0.03). These data show that the presence of IgG antibodies may prevent the detection of a specific IgE response in these parasite diseases. RF-absorbent, a reagent that blocks IgG-binding sites and also removes rheumatoid factor, was more efficient than protein G for the demonstration of specific IgE antibodies.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Leishmaniasis is a disease caused by protozoa of the genus Leishmania, and visceral leishmaniasis is a form in which the inner organs are affected. Since knowledge about immunity in experimental visceral leishmaniasis is poor, we present here a review on immunity and immunosuppression in experimental visceral leishmaniasis in mouse and hamster models. We show the complexity of the mechanisms involved and differences when compared with the cutaneous form of leishmaniasis. Resistance in visceral leishmaniasis involves both CD4+ and CD8+ T cells, and interleukin (IL)-2, interferon (IFN)- gamma, and IL-12, the latter in a mechanism independent of IFN- gamma and linked to transforming growth factor (TGF)-ß production. Susceptibility involves IL-10 but not IL-4, and B cells. In immune animals, upon re-infection, the elements involved in resistance are different, i.e., CD8+ T cells and IL-2. Since one of the immunopathological consequences of active visceral leishmaniasis in humans is suppression of T-cell responses, many studies have been conducted using experimental models. Immunosuppression is mainly Leishmania antigen specific, and T cells, Th2 cells and adherent antigen-presenting cells have been shown to be involved. Interactions of the co-stimulatory molecule family B7-CTLA-4 leading to increased level of TGF-ß as well as apoptosis of CD4+ T cells and inhibition of macrophage apoptosis by Leishmania infection are other components participating in immunosuppression. A better understanding of this complex immune response and the mechanisms of immunosuppression in experimental visceral leishmaniasis will contribute to the study of human disease and to vaccine development.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The traditional concept that effector T helper (Th) responses are mediated by Th1/Th2 cell subtypes has been broadened by the recent demonstration of two new effector T helper cells, the IL-17 producing cells (Th17) and the follicular helper T cells (Tfh). These new subsets have many features in common, such as the ability to produce IL-21 and to express the IL-23 receptor (IL23R), the inducible co-stimulatory molecule ICOS, and the transcription factor c-Maf, all of them essential for expansion and establishment of the final pool of both subsets. Tfh cells differ from Th17 by their ability to home to B cell areas in secondary lymphoid tissue through interactions mediated by the chemokine receptor CXCR5 and its ligand CXCL13. These CXCR5+ CD4+ T cells are considered an effector T cell type specialized in B cell help, with a transcriptional profile distinct from Th1 and Th2 cells. The role of Tfh cells and its primary product, IL-21, on B-cell activation and differentiation is essential for humoral immunity against infectious agents. However, when deregulated, Tfh cells could represent an important mechanism contributing to exacerbated humoral response and autoantibody production in autoimmune diseases. This review highlights the importance of Tfh cells by focusing on their biology and differentiation processes in the context of normal immune response to infectious microorganisms and their role in the pathogenesis of autoimmune diseases.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Thymosin alpha 1 (Tα1) has been shown to have beneficial effects on numerous immune system parameters, but little is known about the effects of Tα1 on patients with gastric carcinoma. The objective of this study was to determine the effect of Tα1 on subpopulations of Th1, Th2, Th17, and regulatory T cells (Tregs) in vitro, and to evaluate its efficacy as an immunoregulatory factor in patients with gastric carcinoma. We compared the effect of Tα1 on the frequency of CD4+ and CD8+ T cells, especially the CD4+CD25+Foxp3+ Tregs in peripheral blood mononuclear cells (PBMCs) from gastric carcinoma patients (N = 35) and healthy donors (N = 22). We also analyzed the changes in the proliferation of PBMCs in response to treatment with Tα1, and examined the production of Th1, Th2, and Th17 cytokines by PBMCs and tumor-infiltrating lymphocytes. The treatment of PBMCs from gastric cancer patients, with Tα1 (50 µg/mL) alone increased the percentage of CD4+CD25+Foxp3+ (suppressive antitumor-specific Tregs) from 1.68 ± 0.697 to 2.19 ± 0.795% (P < 0.05). Our results indicate that Tα1 increases the percentage of Tregs and IL-1β, TNF-α, and IL-6 in vitro.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

It has been reported that production of IL-2 and IFN-g, known as T-helper type 1 cytokines, by peripheral mononuclear cells (PBMC) decreases with progression of HIV infection. In contrast, IL-4 and IL-10 production, Th2 cytokine profile, increases with HIV disease progression. PBMC were evaluated from 55 HIV-infected subjects from Divisão de Imunologia, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo, to "in vitro" cytokines production after 24 hours of stimulation with PHA. Low levels of IL-4 production in both HIV- infected patients and normal subjects, were detected. The patients with CD4+ T cell counts <200 showed a significant decrease of IL-2 and IFN-g production compared to controls. Patients with higher counts of CD4+ T cells (either between 200-500 or >500 cells/mm3) also showed decreased production of IL-2 that was not statistically significant. There was a correlation between IL-2 and IFN-g release with CD4+ T cells counts. HIV-1-infected individuals with CD4+ T cells >500 cells/mm3 showed increased levels of IL-2 and IFN-g, than individuals with CD4+ T cells <500 cells/mm3. In conclusion, we observed a decline of IL-2 and IFN-g production at advanced HIV disease. IL-4 production was not affected during HIV infection. Taken together, these findings suggest that the cytokine profile might be influenced by the HIV infection rather than the cause of disease progression.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

HIV coinfection modifies the clinical course of leishmaniasis by promoting a Th2 pattern of cytokine production. However, little information is available regarding the lymphocytic response in untreated coinfected patients. This work presents the immunophenotyping of Leishmania-stimulated T cells from a treatment-naÏve HIV+ patient with ML. Leishmania braziliensis antigens induced CD69 expression on CD3+CD4+ and CD3+CD8+ cells. It also increased IL-4 intracellular staining on CD3+CD4+GATA3- population and decreased the percentage of CD3+CD4+IL-17+ cells. This suggests that modulations in the IL-4R/STAT6 pathway and the Th17 population may serve as parasitic evasion mechanisms in HIV/ML. Further studies are required to confirm these results.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

T cell clones were derived from peripheral blood mononuclear cells of Schistosoma haematobium infected and uninfected individuals living in an endemic area. The clones were stimulated with S. haematobium worm and egg antigens and purified protein derivative. Attempts were made to classify the T cell clones according to production of the cytokines IL-4, IL-5 and IFN-gamma. All the T cell clones derived were observed to produce cytokines used as markers for the classification of Th1/Th2 subsets. However, the 'signature' cytokines marking each subset were produced at different levels. The classification depended on the dominating cytokine type, which was having either Th0/1 or Th0/2 subsets. The results indicated that no distinct cytokine profiles for polarisation of Th1/Th2 subsets were detected in these S. haematobium infected humans. The balance in the profiles of cytokines marking each subset were related to infection and re-infection status after treatment with praziquantel. In the present study, as judged by the changes in infection status with time, the T cell responses appeared to be less stable and more dynamic, suggesting that small quantitative changes in the balance of the cytokines response could result in either susceptibility or resistant to S. haematobium infection.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the present study we evaluated T cell proliferation and Th lymphokine patterns in response to gp43 from Paracoccidioides brasiliensis presented by isolated dendritic cells from susceptible and resistant mice. T cell proliferation assays showed that dendritic cells from susceptible mice were less efficient than those from resistant mice. The pattern of T cell lymphokines stimulated by dendritic cells was always Th1, although the levels of IL-2 and IFN-gamma were lower in T cell cultures from susceptible mice. To determie whether different antigen-presenting cells such as macrophages and dendritic cells stimulated different concentrations of Th1 lymphokines, the production of IFN-gamma and IL-2 was measured. It was observed that dendritic cells were more efficient than macrophages in stimulating lymphoproliferation in resistant mice. However, no significant difference was observed for IFN-gamma or IL-2 production. When cells from susceptible mice were used, macrophages were more efficient in stimulating lymphoproliferation than dendritic cells, but no difference was observed in the production of Th1 cytokine. Taken together, these results suggest the lower efficiency of dendritic cells and macrophages from B10.A mice in stimulating T cells that secrete Th1 lymphokines in vitro, an effect that may be involved in the progression of the disease in vivo.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Calf serum and fetal bovine serum present great variability as to its growth promoting efficiency (GPE). As supplement of culture media to cultivate cells of animal origin they stimulate the "in vitro" multiplication and maintain cell viability. When fourteen lots of calf sera of variable GPE had the total protein contents as well as the percentages of serum fractions determined, no significant differences that could possibly explain the variability of the GPE were observed. Evaluation of the antiproteolytic activity of nineteen lots of calf serum and eighteen serum lots of younger calves showed that the former exhibited lower antiproteolytic titers (1:40 to 1:80) than the latter (1:80 to 1:160). Twelve lots of fetal bovine serum studied in parallel, showed the highest concentration of antiproteolytic factors, with titers equal to 1:320. Sera of bovine origin, but not fetal sera, are usually heat-inactivated, what was demonstrated to be responsible for the decrease of the antiproteolytic activity of 75% of the lots tested. This could explain the inability of certain heat-inactivated sera in promoting multiplication of some cells "in vitro", as verified with primary monkey kidney cells. The results obtained in this study indicated the convenience of submiting each lot of serum to be introduced in cell culture to previous determination of its characteristics, such as growth promoting efficiency, antiproteolytic activity and also toxicity, absence of extraneous agents, etc., in order to minimize the possibility of using serum lots of questionable quality, thus preventing not only the loss of cell lines, but also undesirable and sometimes expensive delays.