31 resultados para Pentagonal barrier
Resumo:
An unusually high incidence of microcephaly in newborns has recently been observed in Brazil. There is a temporal association between the increase in cases of microcephaly and the Zika virus (ZIKV) epidemic. Viral RNA has been detected in amniotic fluid samples, placental tissues and newborn and fetal brain tissues. However, much remains to be determined concerning the association between ZIKV infection and fetal malformations. In this study, we provide evidence of the transplacental transmission of ZIKV through the detection of viral proteins and viral RNA in placental tissue samples from expectant mothers infected at different stages of gestation. We observed chronic placentitis (TORCH type) with viral protein detection by immunohistochemistry in Hofbauer cells and some histiocytes in the intervillous spaces. We also demonstrated the neurotropism of the virus via the detection of viral proteins in glial cells and in some endothelial cells and the observation of scattered foci of microcalcifications in the brain tissues. Lesions were mainly located in the white matter. ZIKV RNA was also detected in these tissues by real-time-polymerase chain reaction. We believe that these findings will contribute to the body of knowledge of the mechanisms of ZIKV transmission, interactions between the virus and host cells and viral tropism.
Resumo:
Acid mine drainage (AMD) is an environmental concern due to the risk of element mobilization, including toxic elements, and inclusion in the food chain. In this study, three cover layers were tested to minimize As, Fe and S mobilization from a substrate from former gold mining, containing pyrite and arsenopyrite. For this purpose, different layers (capillary break, sealant and cover layer) above the substrate and the induction of a geochemical barrier (GB) were used to provide suitable conditions for adsorption and co-precipitation of the mobilized As. Thirteen treatments were established to evaluate the leaching of As, Fe and S from a substrate in lysimeters. The pH, As, Fe, S, Na, and K concentrations and total volume of the leachates were determined. Mineralogical analyses were realized in the substrate at the end of the experimental period. Lowest amounts of As, Fe and S (average values of 5.47, 48.59 and 132.89 g/lysimeter) were leached in the treatments that received Na and K to induce GB formation. Mineralogical analyses indicated jarosite formation in the control treatment and in treatments that received Na and K salts. However, the jarosite amounts in these treatments were higher than in the control, suggesting that these salts accelerated the GB formation. High amounts of As, Fe and S (average values of 11.7, 103.94 and 201.13 g/lysimeter) were observed in the leachate from treatments without capillary break layer. The formation of geochemical barrier and the use of different layers over the sulfide substrate proved to be efficient techniques to decrease As, Fe and S mobilization and mitigate the impact of acid mine drainage.
Resumo:
Este trabalho foi realizado com o objetivo de estabelecer a melhor concentração de sais do meio MS e da citocinina BAP para a multiplicação dos porta-enxertos de Prunus sp. 'Barrier' e 'Cadaman'. Segmentos nodais foram introduzidos em tubos de ensaio contendo 10 mL de meio de cultura com variações na concentração de sais (MS; ½MS; e 2/3MS) combinadas com cinco concentrações de BAP (0; 1,5; 2,5; 3,5 e 4,5 miM). Utilizou-se um fatorial 2x3x5, distribuído em blocos casualizados, compostos por quatro repetições contendo cinco tubos de ensaio cada uma, sendo inoculado um segmento nodal por tubo. As avaliações foram realizadas após cinco semanas de cultivo em ambiente com intensidade luminosa de 20 miE m-2 s-1, fotoperíodo de 16 horas e temperatura de 24 ± 4ºC. Verificou-se maior número médio de gemas e de brotações para a cultivar Barrier. À medida que se reduziu a concentração de sais do meio de cultura, obteve-se maior número de brotações, porém com menor tamanho. As regressões polinomiais das variáveis número de gemas, brotações por explante e comprimento das brotações apresentaram um ajustamento quadrático para níveis de BAP, atingindo os pontos de máximo 31,2 gemas/explante; 4,6 brotações por explante, e 8,1 mm de comprimento nas concentrações 3,3; 3,1, e 3,1 miM de BAP, respectivamente.
Resumo:
Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
All essential nutrients can affect the incidence and severity of plant diseases. Although silicon (Si) is not considered as an essential nutrient for plants, it stands out for its potential to decrease disease intensity in many crops. The mechanism of Si action in plant resistance is still unclear. Si deposition in plant cell walls raised the hypothesis of a possible physical barrier to pathogen penetration. However, the increased activity of phenolic compounds, polyphenol oxidases and peroxidases in plants treated with Si demonstrates the involvement of this element in the induction of plant defense responses. The studies examined in this review address the role of Si in disease control and the possible mechanisms involved in the mode of Si action in disease resistance in plants.
Resumo:
OBJETIVO: Observar detalhes morfológicos de ovos de Haemagogus leucocelaenus visualizados pela primeira vez por microscopia eletrônica de varredura (MEV) e realizar morfometria das principais estruturas. MÉTODOS: Foram utilizados ovos de Hg. leucocelaenus provenientes de fêmeas capturadas na Reserva Biológica do Tinguá, RJ, sendo parte destinada à eclosão e outra ao processamento de MEV, dos quais três foram submetidos à análise morfométrica. O material foi fixado em glutaraldeído 2,5% e pós-fixado em tetróxido de ósmio 1%, ambos em tampão cacodilato de sódio 0.1M, pH 7.2, processado e observado ao MEV Jeol 5310. Medições foram realizadas com o auxílio do software de análise Semafore. RESULTADOS: Os ovos apresentaram contorno elíptico com aproximadamente 574 µm de comprimento e 169 µm de largura, sendo o índice do ovo (l/wratio) 3,39 µm. O exocório é extremamente regular, possuindo ornamentação hexagonal e algumas vezes pentagonal. Nas células coriônicas, observaram-se tubérculos simetricamente dispostos com relação ao eixo longitudinal, e, no interior delas, tubérculos menores, individualizados, dispostos na periferia, e poucos agrupados no centro. A superfície do retículo coriônico não apresentou rugosidades. O aparelho micropilar apresenta colar proeminente, contínuo, com disco micropilar bem evidente. CONCLUSÕES: A ornamentação do exocório apresenta diferenças em relação aos tubérculos das células coriônicas e ao retículo coriônico externo entre os ovos de Hg. leucocelaenus comparados aos ovos de Hg. janthinomys e Hg. equinus, bem como com relação aos de Aedes aegypti, Ae. albopictus e Ae bahamensis.
Resumo:
OBJECTIVE: To evaluate knowledge, attitude and practice related to mammography among women users of local health services, identifying barriers to its performance. METHODS: A total of 663 women were interviewed at 13 local health centers in a city of Southeastern Brazil, in 2001. Interviewees were randomly selected at each center and they were representative from different socioeconomic conditions. The number of interviewees at each center was proportional to monthly mean appointments. For data analysis, answers were described as knowledge, attitude, practice and their respective adequacies and then they were correlated with control variables through the chi-square test. RESULTS: Only 7.4% of the interviewees had adequate knowledge on mammography, while 97.1% of women had an adequate attitude. The same was seen for the practice of mammography that was adequate in 35.7% of the cases. The main barrier to mammography was lack of referral by physicians working at the health center (81.8%). There was an association between adequacy of attitude and five years or more of education and being married. There was also an association between adequacy of mammography practice and being employed and family income up to four minimum wages. CONCLUSIONS: Women users of local health services had no adequate knowledge and practice related to mammography despite having an adequate attitude about this exam.
Resumo:
A seroepidemiologic survey was carried out in schoolchildren from public schools of the Niterói municipality, state of Rio de Janeiro, Brazil, after a period of sequential epidemics by dengue virus type 1 and 2 (DEN-1 and DEN-2). 450 blood samples were obtained by fingertip puncture and collected on filter paper discs. The hemagglutination inhibition (HAI) test was carried out using DEN-1 and DEN-2 antigens. HAI titres were demonstrated in 66% (297/450) of the sera and the geometric means of the titres were 1/182 and 1/71 for DEN-1 and DEN-2, respectively. Secondary infections were observed in 61% (181/297) of positive cases. Among these, 75% (135/181) were under fifteen years old. No dengue haemorrhagic fever (DHF) was reported in these children. Asymptomatic or oligosymptomatic infections were detected in 56% of the studied population. The absolute and relative frequencies of positive tests by age group and sex did not evidence statistically significant difference. The number of individuals infected probably produced a immunologic barrier responsible for the non occurrence of dengue epidemic in the latter years.
Resumo:
Necrotizing enterocolitis is the most frequently occurring gastrointestinal disorder in premature neonates. Animal models of necrotizing enterocolitis and prenatal administration of cortisone have demonstrated that cortisone may accelerate maturation of the mucosal barrier, therefore reducing the incidence of this gastrointestinal disorder. The authors present a review of the literature of the most important risk factors associated with necrotizing enterocolitis, such as inflammatory gastrointestinal mediators, enteral feeding and bacterial colonization, and immaturity of the gastrointestinal barrier, and we emphasize the necessity for additional studies to explore the prenatal administration of cortisone as a preventive strategy for necrotizing enterocolitis.
Resumo:
Rosewood (Aniba rosaeodora Ducke, Lauraceae) is an Amazonian evergreen tree and a source of the purest linalool, the main component of its essential oil, which is very valuable in the international perfumery market. After decades of over-exploitation it is currently considered as threatened. We evaluated the genetic diversity and its distribution in four populations in Central Amazonia. Thirty-five reliable RAPD markers were generated, of which 32 were polymorphic (91.4%). Variation was higher within the populations (76.5%; p < 0.0001) and geographic distribution contributed to population differentiation (23.4%; p < 0.0001). The Amazon River had a small influence on gene flow (3.3%; p < 0.0001), but we identified evidence of gene flow across the river. There were significant differences in marker frequencies (p < 0.05), in agreement with the low gene flow (Nm = 2.02). The correlation between genetic distance and gene flow was - 0.95 (p = 0.06) and between geographic distance and gene flow was -0.78 (p = 0.12). There was a geographic cline of variability across an East-West axis, influenced as well by the Amazon River, suggesting the river could be a barrier to gene flow. Although threatened, these Rosewood populations retain high diversity, with the highest levels in the Manaus population, which has been protected for over 42 years in a Reserve.
Resumo:
Columnar cell apical membranes (CCAM) in series with goblet cell apical membranes (GCAM) form an electroosmotic barrier separating the midgut lumen from epithelial cell cytoplasm. A unique K+ ATPase in GCAM generates three gradients across this barrier. A greater than 180 mV electrical gradient (lumen positive) drives amino acid uptake through voltage-dependent K+ symports. A greater than 1000-fold [H+] gradient (lumen alkaline) and a greater than 10-fold [K+] gradient (lumen concentrated) are adaptations to the high tannin and high K+ content, respectively, in dietary plant material. Agents which act on the apical membrane and disrupt the PD, H+, or K+ gradients are potential insecticides. Insect sensory epithelia and mammalian stria vascularis maintain similar PD and K+ gradients but would not be exposed to ingested anti-apical membrane insecticides. Following the demonstration by Sacchi et al. that Bacillus thuringiensis delta-endotoxin (Bt) induces specifically a K+ conductance increase in CCAM vesicles, we find that the K+ channel blocking agent, Ba2+, completely reverses Bt inhibition of the K+-carried short circuit current in the isolated midgut of Manduca sexta. Progress in characterizing the apical membrane includes finding that fluorosulfonylbenzoyladenosine binds specifically to certain GCAM polypeptides and that CCAM vesicles can be mass produced by Ca2+ or Mg2+ precipitation from Manduca sexta midgut.