24 resultados para Nombres impairs


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A designação científica das espécies vegetais consideradas plantas daninhas é a mesma em qualquer parte do mundo, o que facilita o seu estudo e intercâmbio de informações entre os pesquisadores que se dedicam a ciência das plantas daninhas. O lavrador, o produtor, o extensionista e as vezes também o pesquisador necessitam referir-se a planta daninha, com fins práticos, por seus nomes vulgares ou populares mais conhecidos. Esta lista inclue o nome científico e os nomes vulgares mais comuns em castelhano, português e inglês de plantas daninhas pertencentes a famílias botânicas amplamente difundidas em diferentes regiões da Argentina e Brasil. Para a eleboração da presente listagem agrupou-se plantas daninhas por famílias e ordenou-se alfabeticamente.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The precise nature of hormones and growth factors directly responsible for cartilage maturation is still largely unclear. Since longitudinal bone growth occurs through endochondral bone formation, excess or deficiency of most hormones and growth factors strongly influences final adult height. The structure and composition of the cartilaginous extracellular matrix have a critical role in regulating the behavior of growth plate chondrocytes. Therefore, the maintenance of the three-dimensional cell-matrix interaction is necessary to study the influence of individual signaling molecules on chondrogenesis, cartilage maturation and calcification. To investigate the effects of insulin on both proliferation and induction of hypertrophy in chondrocytes in vitro we used high-density micromass cultures of chick embryonic limb mesenchymal cells. Culture medium was supplemented with 1% FCS + 60 ng/ml (0.01 µM) insulin and cultures were harvested at regular time points for later analysis. Proliferating cell nuclear antigen immunoreactivity was widely detected in insulin-treated cultures and persisted until day 21 and [³H]-thymidine uptake was highest on day 14. While apoptosis increased in control cultures as a function of culture time, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-labeled cells were markedly reduced in the presence of insulin. Type II collagen production, alkaline phosphatase activity and cell size were also lower in insulin-treated cultures. Our results indicate that under the influence of 60 ng/ml insulin, chick chondrocytes maintain their proliferative potential but do not become hypertrophic, suggesting that insulin can affect the regulation of chondrocyte maturation and hypertrophy, possibly through an antiapoptotic effect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We determined the effect of an H1 receptor antagonist on the functional recovery of Carassius auratus submitted to telencephalic ablation. Five days after surgery the fish underwent a spatial-choice learning paradigm test. The fish, weighing 6-12 g, were divided into four groups: telencephalic ablation (A) or sham lesion (S) and saline (SAL) or chlorpheniramine (CPA, ip, 16 mg/kg). For eight consecutive days each animal was trained individually in sessions separated by 24 h (alternate days). Training trials (T1-T8) consisted of finding the food in one of the feeders, which were randomly blocked for each subject. Animals received an intraperitoneal injection of SAL or CPA 10 min after the training trials. The time spent by the animals in each group to find the food (latency) was analyzed separately at T1 and T8 by the Kruskal-Wallis test, followed by the Student Newman-Keuls test. At T1 the latencies (mean ± SEM) of the A-SAL (586.3 ± 13.6) and A-CPA (600 ± 0) groups were significantly longer than those of the S-SAL (226.14 ± 61.15) and S-CPA (356.33 ± 68.8) groups. At T8, the latencies of the A-CPA group (510.11 ± 62.2) remained higher than those of the other groups, all of which showed significantly shorter latencies (A-SAL = 301.91 ± 78.32; S-CPA = 191.58 ± 73.03; S-SAL = 90.28 ± 41) compared with T1. These results support evidence that training can lead to functional recovery of spatial-choice learning in telencephalonless fish and also that the antagonist of the H1 receptor impairs it.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study investigated the effect of thioperamide (THIO), an H3 histaminergic receptor antagonist, microinjected into the cerebellar vermis on emotional memory consolidation in male Swiss albino mice re-exposed to the elevated plus-maze (EPM). We implanted a guide cannula into the cerebellar vermis using stereotactic surgery. On the third day after surgery, we performed behavioral tests for two consecutive days. On the first day (exposure), the mice (n=10/group) were exposed to the EPM and received THIO (0.06, 0.3, or 1.5 ng/0.1 µL) immediately after the end of the session. Twenty-four hours later, the mice were re-exposed to the EPM under the same experimental conditions, but without drug injection. A reduction in the exploration of the open arms upon re-exposure to the EPM (percentage of number of entries and time spent in open arms) compared with the initial exposure was used as an indicator of learning and memory. One-way analysis of variance (ANOVA) followed by the Duncan post hoc test was used to analyze the data. Upon re-exposure, exploratory activity in the open arms was reduced in the control group, and with the two highest THIO doses: 0.3 and 1.5 ng/0.1 µL. No reduction was seen with the lowest THIO dose (0.06 ng/0.1 µL), indicating inhibition of the consolidation of emotional memory. None of the doses interfered with the animals' locomotor activity. We conclude that THIO at the lowest dose (0.06 ng/0.1 µL) microinjected into the cerebellum impaired emotional memory consolidation in mice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

ABSTRACT Maintaining cantaloupe melon at field temperature impairs conservation as it speeds up cell metabolism and transpiration, and, consequently, reduces shelf life. This study aimed to evaluate the conservation of Torreon hybrid cantaloupe using the hydrocooling treatment. Fruits were harvested at the commercial maturity stage (60 days after planting), in the morning, at the Nova California Farm, municipality of Mossoró-RN, in September 2007. One set of fruit was immersed in chilled water at 5 ºC for 5 min, at the packing house, while the remaining set was not hydro cooled. Then, both sets (treated and untreated with hydrocooling) were pre-cooled in air forced tunnels at 7 ºC, until the temperature in the pulp reached 10 ºC. Both fruit sets were stored for 0, 14, 21, 28 and 35 days under modified atmosphere at 3 ± 1 oC and 90 ± 5% RH. After each storage period, the fruits were incubated in an atmosphere-controlled chamber at 20 ± 2 oC and 80 ± 5% de RH, for seven days. The following characteristics were evaluated: external and internal appearance, mass loss, soluble solids, firmness and titrable acidity. The experiment was arranged in a completely randomized split-plot design with four replications of three fruits. The plots consisted of the hydrocooling conditions (with and without fruit soaking in chilled water), and the sub-plots consisted of the storage times (0, 14, 21, 28 and 35 days).The treatment with hydrocooling was efficient in keeping the firmness and soluble solids of the fruits and shortened the pre-cooling time in the cooling tunnel. However, hydrocooling did not increase fruit shelf-life.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Liver transplantation is now the standard treatment for end-stage liver disease. Given the shortage of liver donors and the progressively higher number of patients waiting for transplantation, improvements in patient selection and optimization of timing for transplantation are needed. Several solutions have been suggested, including increasing the donor pool; a fair policy for allocation, not permitting variables such as age, gender, and race, or third-party payer status to play any role; and knowledge of the natural history of each liver disease for which transplantation is offered. To observe ethical rules and distributive justice (guarantee to every citizen the same opportunity to get an organ), the "sickest first" policy must be used. Studies have demonstrated that death has no relationship with waiting time, but rather with the severity of liver disease at the time of inclusion. Thus, waiting time is no longer part of the United Network for Organ Sharing distribution criteria. Waiting time only differentiates between equally severely diseased patients. The authors have analyzed the waiting list mortality and 1-year survival for patients of the State of São Paulo, from July 1997 through January 2001. Only the chronological criterion was used. According to "Secretaria de Estado da Saúde de São Paulo" data, among all waiting list deaths, 82.2% occurred within the first year, and 37.6% within the first 3 months following inclusion. The allocation of livers based on waiting time is neither fair nor ethical, impairs distributive justice and human rights, and does not occur in any other part of the world.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Con base en información obtenida sobre los nombres de todas las plantas con DAP > 2.5 cm (Diámetro a la Altura del Pecho, medido a una altura de 1.3 m) dentro de 30 parcelas de 0.1 ha cada una, y sobre los suelos, la vegetación y el paisaje a lo largo de 8 transectos (entre 2 y 5 km de longitud cada uno), se describen los aspectos más importantes sobre la taxonomía botánica y el ordenamiento o jerarquización del medio ambiente desde la perspectiva de los Indígenas Miraña de la Amazonía central colombiana. A pesar de la pérdida cultural, algunos pocos ancianos guardan como parte de su tradición oral, los elementos básicos de un sistema complejo de conocimiento de su ambiente natural. Se detectó un alto grado de conocimiento sobre las especies vegetales silvestres, la existencia de sistemas nomenclaturales para éstas y para los suelos, y un reconocimiento organizado de paisajes fisiográficos y tipos de vegetación.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Observational studies have attributed a protective effect to alcohol consumption on the development of atherosclerosis and cardiovascular morbidity and mortality. Alcohol intake in the amount of one to two drinks per day results in an estimated 20-40% reduction in cardiovascular events. An additional protective effect, according to major cohort studies, has been attributed to wine, probably due to antioxidant effects and platelet antiaggregation agents. On the other hand, the influence of different patterns of alcohol consumption and environmental factors may explain a great part of the additional effect of wine. Protection may be mediated by modulation of other risk factors, because alcohol increases HDL-C, produces a biphasic response on blood pressure, and modulates the endothelial function, while it neither increases body weight nor impairs glucose-insulin homeostasis. Alcohol may also have a direct effect on atherogenesis. Despite these favorable effects, the current evidence is not enough to justify prescribing alcohol to prevent cardiovascular disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The mobility of boron (B), a commonly deficient micronutrient in cotton, has been shown to be low in the plant phloem. Nevertheless, studies have indicated that cotton cultivars can respond differently to B application. A greenhouse experiment was conducted to compare B absorption and mobility in cotton cultivars grown in nutrient solution. Treatments consisted of three cotton cultivars (FMT 701, DP 604BG and FMX 993), and five B rates (0.0, 2.5, 5.0, 10.0, and 20.0 µmol L-1). Plant growth and development were monitored for four weeks from the appearance of the first square. The time of onset and severity of B deficiency symptoms varied among cotton cultivars. Initial B uptake of cv. DP 604BG was lower than of the other cultivars, but a greater amount of available B in the nutrient solution was required to prevent deficiency symptoms in this cultivar. Boron deficiency impairs cotton growth, with no differences among cultivars, regardless of the time of appearance and intensity of B deficiency symptoms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Se analizaron las taxonomías web navegacionales de clubes de fútbol argentinos, con el propósito de identificar sus taxones y las categorías subyacentes, así como elaborar una taxonomía común, basada en las categorías fundamentales recomendadas por el Classification Research Group, para comparar las taxonomías analizadas y comprobar si pueden ser desarrolladas mediante el método del análisis por facetas. El análisis de los taxones muestra una tendencia a usar términos en inglés y nombres propios o específicos relacionados con aspectos emocionales e identificatorios de cada club, que puede requerir cambios en la aplicación tradicional de las normas de control de vocabulario. El uso de las categorías fundamentales permitiría un análisis más exhaustivo de la información a colocar en el sitio web y un mejor diseño de la taxonomía, siendo una herramienta útil para el bibliotecario interesado en este tipo de recurso.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objetive of this work was to evaluate the influence of intergenotypic competition in open-pollinated families of Eucalyptus and its effects on early selection efficiency. Two experiments were carried out, in which the timber volume was evaluated at three ages, in a randomized complete block design. Data from the three years of evaluation (experiment 1, at 2, 4, and 7 years; and experiment 2, at 2, 5, and 7 years) were analyzed using mixed models. The following were estimated: variance components, genetic parameters, selection gains, effective number, early selection efficiency, selection gain per unit time, and coincidence of selection with and without the use of competition covariates. Competition effect was nonsignificant for ages under three years, and adjustment using competition covariates was unnecessary. Early selection for families is effective; families that have a late growth spurt are more vulnerable to competition, which markedly impairs ranking at the end of the cycle. Early selection is efficient according to all adopted criteria, and the age of around three years is the most recommended, given the high efficiency and accuracy rate in the indication of trees and families. The addition of competition covariates at the end of the cycle improves early selection efficiency for almost all studied criteria.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

(ANP, 1 &micro;M) on the kinetics of bicarbonate reabsorption in the rat middle proximal tubule, we performed in vivo experiments using a stopped-flow microperfusion technique with the determination of lumen pH by Sb microelectrodes. These studies confirmed that ANG II added to the luminal or peritubular capillary perfusion fluid stimulates proximal bicarbonate reabsorption and showed that ANP alone does not affect this process, but impairs the stimulation caused by ANG II. We also studied the effects and the interaction of these hormones in cortical distal nephron acidification. Bicarbonate reabsorption was evaluated by the acidification kinetic technique in early (ED) and late (LD) distal tubules in rats during in vivo stopped-flow microperfusion experiments. The intratubular pH was measured with a double-barreled microelectrode with H+-sensitive resin. The results indicate that ANG II acted by stimulating Na+/H+ exchange in ED (81%) and LD (54%) segments via activation of AT1 receptors, as well as vacuolar H+-ATPase in LD segments (33%). ANP did not affect bicarbonate reabsorption in either segment and, as opposed to what was seen in the proximal tubule, did not impair the stimulation caused by ANG II. To investigate the mechanism of action of these hormones in more detail, we studied cell pH dependence on ANG II and ANP in MDCK cells using the fluorescent probe BCECF. We showed that the velocity of cell pH recovery was almost abolished in the absence of Na+, indicating that it is dependent on Na+/H+ exchange. ANP (1 &micro;M) alone had no effect on this recovery but reversed both the acceleration of H+ extrusion at low ANG II levels (1 pM and 1 nM), and inhibition of H+ extrusion at higher ANG II levels (100 nM). To obtain more information on the mechanism of interaction of these hormones, we also studied their effects on the regulation of intracellular free calcium concentration, [Ca2+]i, monitored with the fluorescent probe Fura-2 in MDCK cells in suspension. The data indicate that the addition of increasing concentrations of ANG II (1 pM to 1 &micro;M) to the cell suspension led to a progressive increase in [Ca2+]i to 2-3 times the basal level. In contrast, the addition of ANP (1 &micro;M) to the cell suspension led to a very rapid 60% decrease in [Ca2+]i and reduced the increase elicited by ANG II, thus modulating the effect of ANG II on [Ca2+]i. These results may indicate a role of [Ca2+]i in the regulation of the H+ extrusion process mediated by Na+/H+ exchange and stimulated/impaired by ANG II. The data are compatible with stimulation of Na+/H+ exchange by increases of [Ca2+]i in the lower range, and inhibition at high [Ca2+]i levels

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Intra-amygdala infusion of the non-N-methyl-D-aspartate (NMDA) receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) prior to testing impairs inhibitory avoidance retention test performance. Increased training attenuates the impairing effects of amygdala lesions and intra-amygdala infusions of CNQX. The objective of the present study was to determine the effects of additional training on the impairing effects of intra-amygdala CNQX on expression of the inhibitory avoidance task. Adult female Wistar rats bilaterally implanted with cannulae into the border between the central and the basolateral nuclei of the amygdala were submitted to a single session or to three training sessions (0.2 mA, 24-h interval between sessions) in a step-down inhibitory avoidance task. A retention test session was held 48 h after the last training. Ten minutes prior to the retention test session, the animals received a 0.5-µl infusion of CNQX (0.5 µg) or its vehicle (25% dimethylsulfoxide in saline). The CNQX infusion impaired, but did not block, retention test performance in animals submitted to a single training session. Additional training prevented the impairing effect of CNQX. The results suggest that amygdaloid non-NMDA receptors may not be critical for memory expression in animals given increased training.