50 resultados para Impulse response function


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this work was to evaluate a generalized response function to the atmospheric CO2 concentration [f(CO2)] by the radiation use efficiency (RUE) in rice. Experimental data on RUE at different CO2 concentrations were collected from rice trials performed in several locations around the world. RUE data were then normalized, so that all RUE at current CO2 concentration were equal to 1. The response function was obtained by fitting normalized RUE versus CO2 concentration to a Morgan-Mercer-Flodin (MMF) function, and by using Marquardt's method to estimate the model coefficients. Goodness of fit was measured by the standard deviation of the estimated coefficients, the coefficient of determination (R²), and the root mean square error (RMSE). The f(CO2) describes a nonlinear sigmoidal response of RUE in rice, in function of the atmospheric CO2 concentration, which has an ecophysiological background, and, therefore, renders a robust function that can be easily coupled to rice simulation models, besides covering the range of CO2 emissions for the next generation of climate scenarios for the 21st century.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

A new procedure to find the limiting range of the photomultiplier linear response of a low-cost, digital oscilloscope-based time-resolved laser-induced luminescence spectrometer (TRLS), is presented. A systematic investigation on the instrument response function with different signal input terminations, and the relationship between the luminescence intensity reaching the photomultiplier and the measured decay time are described. These investigations establish that setting the maximum intensity of the luminescence signal below 0.3V guarantees, for signal input terminations equal or higher than 99.7 ohm, a linear photomultiplier response.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Non-linear functional representation of the aerodynamic response provides a convenient mathematical model for motion-induced unsteady transonic aerodynamic loads response, that accounts for both complex non-linearities and time-history effects. A recent development, based on functional approximation theory, has established a novel functional form; namely, the multi-layer functional. For a large class of non-linear dynamic systems, such multi-layer functional representations can be realised via finite impulse response (FIR) neural networks. Identification of an appropriate FIR neural network model is facilitated by means of a supervised training process in which a limited sample of system input-output data sets is presented to the temporal neural network. The present work describes a procedure for the systematic identification of parameterised neural network models of motion-induced unsteady transonic aerodynamic loads response. The training process is based on a conventional genetic algorithm to optimise the network architecture, combined with a simplified random search algorithm to update weight and bias values. Application of the scheme to representative transonic aerodynamic loads response data for a bidimensional airfoil executing finite-amplitude motion in transonic flow is used to demonstrate the feasibility of the approach. The approach is shown to furnish a satisfactory generalisation property to different motion histories over a range of Mach numbers in the transonic regime.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The objective of this study was to improve the simulation of node number in soybean cultivars with determinate stem habits. A nonlinear model considering two approaches to input daily air temperature data (daily mean temperature and daily minimum/maximum air temperatures) was used. The node number on the main stem data of ten soybean cultivars was collected in a three-year field experiment (from 2004/2005 to 2006/2007) at Santa Maria, RS, Brazil. Node number was simulated using the Soydev model, which has a nonlinear temperature response function [f(T)]. The f(T) was calculated using two methods: using daily mean air temperature calculated as the arithmetic average among daily minimum and maximum air temperatures (Soydev tmean); and calculating an f(T) using minimum air temperature and other using maximum air temperature and then averaging the two f(T)s (Soydev tmm). Root mean square error (RMSE) and deviations (simulated minus observed) were used as statistics to evaluate the performance of the two versions of Soydev. Simulations of node number in soybean were better with the Soydev tmm version, with a 0.5 to 1.4 node RMSE. Node number can be simulated for several soybean cultivars using only one set of model coefficients, with a 0.8 to 2.4 node RMSE.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Although several studies have been conducted to evaluate the uniformity of water application under center pivot irrigation systems, there are few studies concerning the economic perspective of such coefficient. The aim of this study is to present a methodology to accomplish an economic analysis as support for the decision-making to retrofit emitters in center pivot irrigation systems, and to attribute an economic meaning to the uniformity coefficient of water application taking into account the response function productivity to the amount of water applied and the sale price of the crops. In the hypothetic calculation example considering the variation of revenue of potato crop under center pivot irrigation system, it was verified that the area with uniformity coefficient of water application of 90% brought an income increase of BR$ 1,992.00, considering an area about 1,0 ha. Thus, it can be concluded that the methodology presented has met the objectives proposed in the study and made it possible to attribute an economical meaning to the coefficient of water uniformity application.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The objective of this study was to simulate the impact of elevated temperature scenarios on leaf development of potato in Santa Maria, RS, Brazil. Leaf appearance was estimated using a multiplicative model that has a non-linear temperature response function which calculates the daily leaf appearance rate (LAR, leaves day-1) and the accumulated number of leaves (LN) from crop emergence to the appearance of the upper last leaf. Leaf appearance was estimated during 100 years in the following scenarios: current climate, +1 °C, +2 °C, +3 °C, +4 °C e +5 °C. The LAR model was estimated with coefficients of the Asterix cultivar in five emergence dates and in two growing seasons (Fall and Spring). Variable of interest was the duration (days) of the crop emergence to the appearance of the final leaf number (EM-FLN) phase. Statistical analysis was performed assuming a three-factorial experiment, with main effects being climate scenarios, growing seasons, and emergence dates in a completely randomized design using years (one hundred) as replications. The results showed that warmer scenarios lead to an increase, in the fall, and a decrease, in the spring growing season, in the duration of the leaf appearance phase, indicating high vulnerability and complexity of the response of potato crop grown in a Subtropical environment to climate change.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

This paper examines two passive techniques for vibration reduction in mechanical systems: the first one is based on dynamic vibration absorbers (DVAs) and the second uses resonant circuit shunted (RCS) piezoceramics. Genetic algorithms are used to determine the optimal design parameters with respect to performance indexes, which are associated with the dynamical behavior of the system over selected frequency bands. The calculation of the frequency response functions (FRFs) of the composite structure (primary system + DVAs) is performed through a substructure coupling technique. A modal technique is used to determine the frequency response function of the structure containing shunted piezoceramics which are bonded to the primary structure. The use of both techniques simultaneously on the same structure is investigated. The methodology developed is illustrated by numerical applications in which the primary structure is represented by simple Euler-Bernoulli beams. However, the design aspects of vibration control devices presented in this paper can be extended to more complex structures.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The effects of human immunodeficiency virus (HIV) on the immune response in patients with cutaneous leishmaniasis have not yet been fully delineated. This study quantified and evaluated the function of memory T-cell subsets in response to soluble Leishmania antigens (SLA) from patients coinfected with HIV and Leishmania with tegumentary leishmaniasis (TL). Eight TL/HIV coinfected subjects and 10 HIV seronegative subjects with TL were evaluated. The proliferative response of CD4+and CD8+T-cells and naïve, central memory (CM) and effector memory (EM) CD4+T-cells in response to SLA were quantified using flow cytometry. The median cell division indices for CD4+and CD8+T-cells of coinfected patients in response to SLA were significantly lower than those in patients with Leishmania monoinfection (p < 0.05). The proportions of CM and EM CD4+T-cells in response to SLA were similar between the coinfected patients and patients with Leishmania monoinfection. However, the median CM and EM CD4+T-cell counts from coinfected patients were significantly lower (p < 0.05). The reduction in the lymphoproliferative response to Leishmaniaantigens coincides with the decrease in the absolute numbers of both EM and CM CD4+T-cells in response to Leishmania antigens in patients coinfected with HIV/Leishmania.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Patients with heart failure who have undergone partial left ventriculotomy improve resting left ventricular systolic function, but have limited functional capacity. We studied systolic and diastolic left ventricular function at rest and during submaximal exercise in patients with previous partial left ventriculotomy and in patients with heart failure who had not been operated, matched for maximal and submaximal exercise capacity. Nine patients with heart failure previously submitted to partial left ventriculotomy were compared with 9 patients with heart failure who had not been operated. All patients performed a cardiopulmonary exercise test with measurement of peak oxygen uptake and anaerobic threshold. Radionuclide left ventriculography was performed to analyze ejection fraction and peak filling rate at rest and during exercise at the intensity corresponding to the anaerobic threshold. Groups presented similar exercise capacity evaluated by peak oxygen uptake and at anaerobic threshold. Maximal heart rate was lower in the partial ventriculotomy group compared to the heart failure group (119 ± 20 vs 149 ± 21 bpm; P < 0.05). Ejection fraction at rest was higher in the partial ventriculotomy group as compared to the heart failure group (41 ± 12 vs 32 ± 9%; P < 0.0125); however, ejection fraction increased from rest to anaerobic threshold only in the heart failure group (partial ventriculotomy = 44 ± 17%; P = non-significant vs rest; heart failure = 39 ± 11%; P < 0.0125 vs rest; P < 0.0125 vs change in the partial ventriculotomy group). Peak filling rate was similar at rest and increased similarly in both groups at the anaerobic threshold intensity (partial ventriculotomy = 2.28 ± 0.55 EDV/s; heart failure = 2.52 ± 1.07 EDV/s; P < 0.0125; P > 0.05 vs change in partial ventriculotomy group). The abnormal responses demonstrated here may contribute to the limited exercise capacity of patients with partial left ventriculotomy despite the improvement in resting left ventricular systolic function.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Upper gastrointestinal endoscopy is often accompanied by tachycardia which is known to be an important pathogenic factor in the development of myocardial ischemia. The pathogenesis of tachycardia is unknown but the condition is thought to be due to the endocrine response to endoscopy. The purpose of the present study was to investigate the effects of sedation on the endocrine response and cardiorespiratory function. Forty patients scheduled for diagnostic upper gastrointestinal endoscopy were randomized into 2 groups. While the patients in the first group did not receive sedation during upper gastrointestinal endoscopy, the patients in the second group were sedated with intravenous midazolam at the dose of 5 mg for those under 65 years or 2.5 mg for those aged 65 years or more. Midazolam was administered by slow infusion. In both groups, blood pressure, ECG tracing, heart rate, and peripheral oxygen saturation (SpO2) were monitored during endoscopy. In addition, blood samples for the determination of cortisol, glucose and C-reactive protein levels were obtained from patients in both groups prior to and following endoscopy. Heart rate and systolic arterial pressure changes were within normal limits in both groups. Comparison of the two groups regarding the values of these two parameters did not reveal a significant difference, while a statistically significant reduction in SpO2 was found in the sedation group. No significant differences in serum cortisol, glucose or C-reactive protein levels were observed between the sedated and non-sedated group. Sedation with midazolam did not reduce the endocrine response and the tachycardia developing during upper gastrointestinal endoscopy, but increased the reduction in SpO2.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cell mediated immune response was studied in patients with recent and chronic Schistosoma mansoni infection. Precultured peripheral mononuclear cells showed significantly higher responses to S. mansoni adult worm antigen (SAWA) when compared to fresh cell preparations. The addition of each patient serum to the precultured cells reactions to SAWA or recall antigens demonstrated a strong inhibitory serum action, which was also noted on allogeneic cells derived from healthy subjects. The CD4 subset was the main responding cell to SAWA being this reactivity highly suppressed by the presence of the monocyte macrophage accessory cells. We stressed the simultaneous inhibitory action of humoral and cellular factors on the specific cell response to S. mansoni.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Leptospirosis severity may be increasing, with pulmonary involvement becoming more frequent. Does this increase result from an intense immune response to leptospire? Notice that renal failure, thrombocytopenia and pulmonary complications are found during the immune phase. Thirty-five hospitalized patients with Weil's disease had 5 blood samples drawn, from the 15th day to the 12th month of symptoms, for ELISA-IgM, -IgG and -IgA specific antibody detection. According their 1st IgG titer, the patients were divided into: group 1 (n = 13) titer > 1:400 (positive) and group 2 (n = 22) titer <=1:400 (negative). Early IgG antibodies in group 1 showed high avidity which may indicate reinfection. Group 1 was older, had worse pulmonary and renal function, and fever for a longer period than group 2. Throughout the study, IgG and IgA titers remained higher in group 1. In conclusion, the severity of Weil's disease may be associated with the intensity of the humoral immune response to leptospire.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: To verify if adaptive left ventricle (LV) characteristics are also present in individuals under 70 years of age with severe aortic stenosis (AS). METHODS: The study comprised 40 consecutive patients under 70 years of age with AS and no associated coronary artery disease, referred for valve surgery. Out of the 40 patients, 22 were men and 18 women, and the mean age was 49.8±14.3 years. Cardiac symptoms, presence of systemic hypertension (SH), functional class according to the New York Heart Association (NYHA), and valve lesion etiology were considered. LV cavity dimensions, ejection fraction (EF), fractional shortening (FS), mass (MS), and relative diastolic thickness (RDT) were examined by Doppler echocardiography. RESULTS: Fourteen (63.6%) men and 11 (61.6%) women were classified as NYHA class III/IV (p=0.70). There was no difference in the frequency of angina, syncope or dyspnea between genders. The incidence of SH was greater in women than in men (10 versus 2, p=0.0044). Women had a smaller LV end-diastolic diameter index (32.1±6.5 x 36.5±5.3mm/m², p=0.027), LV end-systolic diameter index (19.9±5.9 x 26.5±6.4mm/m², p=0.0022) and LV mass index (MS) (211.4±71.1 x 270.9±74.9g/m², p=0.017) when compared with men. EF (66.2±13.4 x 52.0±14.6%, p=0.0032), FS (37.6±10.7 x 27.9±9.6%, p=0.0046) and RDT (0.58±0.22 x 0.44±0.09, p=0.0095) were significantly greater in women than in men. CONCLUSION: It is the patient gender rather than age that influences left ventricular adaptive response to AS.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: To assess the acute effects of high glucose concentrations on vascular reactivity in the isolated non diabetic rabbit kidney. METHODS: Rabbits were anaesthetized for isolation of the kidneys. Renal arteries and veins were cannulated for perfusion with Krebs-Henselleit solution and measurement of perfusion pressure. After 3 hours of perfusion with glucose 5,5 mM (control ) and 15 mM, the circulation was submitted to sub maximal precontraction (80% of maximal response) trough continuous infusion of noradrenaline 10 mM. Vascular reactivity was then assessed trough dose-responses curves with endothelium-dependent (acetylcholine) and independent (sodium nitroprusside) vasodilators. The influence of hyperosmolarity was analyzed with perfusion with mannitol 15mM. RESULTS: A significant reduction in the endothelium-dependent vasodilation in glucose 15mM group was observed compared to that in control, but there was no difference in endothelium-independent vasodilation. After perfusion with mannitol 15 mM, a less expressive reduction in endothelium-dependent vasodilation was observed, only reaching significance in regard to the greatest dose of acetylcholine. CONCLUSION: High levels of glucose similar to those found in diabetic patients in the postprandial period can cause significant acute changes in renal vascular reactivity rabbits. In diabetic patients these effects may also occur and contribute to diabetes vascular disease.