Characterization of new Schistosoma mansoni microsatellite loci in sequences obtained from public DNA databases and microsatellite enriched genomic libraries

In the last decade microsatellites have become one of the most useful genetic markers used in a large number of organisms due to their abundance and high level of polymorphism. Microsatellites have been used for individual identification, paternity tests, forensic studies and population genetics. Data on microsatellite abundance comes preferentially from microsatellite enriched libraries and DNA sequence databases. We have conducted a search in GenBank of more than 16,000 Schistosoma mansoni ESTs and 42,000 BAC sequences. In addition, we obtained 300 sequences from CA and AT microsatellite enriched genomic libraries. The sequences were searched for simple repeats using the RepeatMasker software. Of 16,022 ESTs, we detected 481 (3%) sequences that contained 622 microsatellites (434 perfect, 164 imperfect and 24 compounds). Of the 481 ESTs, 194 were grouped in 63 clusters containing 2 to 15 ESTs per cluster. Polymorphisms were observed in 16 clusters. The 287 remaining ESTs were orphan sequences. Of the 42,017 BAC end sequences, 1,598 (3.8%) contained microsatellites (2,335 perfect, 287 imperfect and 79 compounds). The 1,598 BAC end sequences 80 were grouped into 17 clusters containing 3 to 17 BAC end sequences per cluster. Microsatellites were present in 67 out of 300 sequences from microsatellite enriched libraries (55 perfect, 38 imperfect and 15 compounds). From all of the observed loci 55 were selected for having the longest perfect repeats and flanking regions that allowed the design of primers for PCR amplification. Additionally we describe two new polymorphic microsatellite loci.

Isolation of a distally located gene possibly correlated with gametocyte production ability

Previous studies were focussed on the attempt to correlate observable variations in the size of Plasmodium berghei chromosomes with the loss of ability to produce viable gametocytes. A temporal coincidence between the appearance of a subtelomeric deletion on P. berghei chromosome 5 and the loss of the ability to produce viable gametocytes was observed in a clone (HPE) directly derived from the high gametocyte-producer clone 8417 during mechanical passages. Interestingly enough, three P. berghei sexual-specific genes have already been mapped on internal fragments of this chromosome. A novel gene, clone 150, isolated from a genomic library of clone 8417 using a probe enriched for sexual-specific transcripts, maps on chromosome 5 within 100kb from the telomere. Subtelomeric deletions of chromosome 5 affecting two non-producer clones involve part of the transcribed region of this gene.

Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

Pentamidine (PEN) is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK) into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

A new repetitive DNA sequence from Trypanosoma cruzi

Tandemly repeated DNA sequences are found in the genome of higher eukaryotes, and have also been demonstrated in Trypanosoma cruzi. Repeated DNA sequences are potentially useful for the diagnostic detection of T. cruzi (A. Gonzales et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 3356-3360). We have isoleted two clones from a genomic library of T. cruzi (Y strain) that contain, in one clone a family of at least seven copies of a repetitive sequence of approximately 600 base pairs, and in the other an independent copy of the same sequence. One copy of the repetition (HSP) and the independent clone (HCR) were sequenced by the Sanger procedure (Fig.). This sequence hybridized to four strains of T. cruzi tested and did not hybridize to eleven species of trypanosotids from five different Genera, being a good candidate for diagnostic assays. GenBank accession numbers: HSP#m31919, HCR#31920.

Variation between geographical populations of Lutzomyia (Nyssomyia) whitmani (Antunes & Coutinho, 1939) sensu lato (Diptera:Psychodidae:Phlebotominae) in Brazil

Phylogenetic analysis of morphometric and biological characters indicated that there are two distinct forms of Lutzomyia whitmani in Brazil: one is present both north and south of the River Amazonas in the State of Pará while the other occurs in northeast Brazil, in the State of Ceará, and further south, including the type locality in State of Bahia. The Amazonian form is reportedly neither strongly anthropophilic nor synanthropic, and it is the vector of Leishmania shawi; whereas the southern form is often collected peridomestically, while biting man, and has been found infected with Le.(V.) braziliensis. The ratio of the length of the genital filaments to that the genital pump was found to be consistently smaller in males of the Amazonian populations. A middle repetitive DNA element was isolated by differentially screening a genomic library made using Amazonian material, and the sequence was diagnostic for this form of Lu. whitmani (being absent or occurring in low copy number in the southern form). The total evidence suggests there are at least two, geographically-isolated forms of Lu. whitmani, which may represent different cryptic species.

Towards the Physical Map of the Trypanosoma cruzi Nuclear Genome: Construction of YAC and BAC Libraries of the Reference Clone T. cruzi CL-Brener

Strategies to construct the physical map of the Trypanosoma cruzi nuclear genome have to capitalize on three main advantages of the parasite genome, namely (a) its small size, (b) the fact that all chromosomes can be defined, and many of them can be isolated by pulse field gel electrophoresis, and (c) the fact that simple Southern blots of electrophoretic karyotypes can be used to map sequence tagged sites and expressed sequence tags to chromosomal bands. A major drawback to cope with is the complexity of T. cruzi genetics, that hinders the construction of a comprehensive genetic map. As a first step towards physical mapping, we report the construction and partial characterization of a T. cruzi CL-Brener genomic library in yeast artificial chromosomes (YACs) that consists of 2,770 individual YACs with a mean insert size of 365 kb encompassing around 10 genomic equivalents. Two libraries in bacterial artificial chromosomes (BACs) have been constructed, BACI and BACII. Both libraries represent about three genome equivalents. A third BAC library (BAC III) is being constructed. YACs and BACs are invaluable tools for physical mapping. More generally, they have to be considered as a common resource for research in Chagas disease

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Study of a region on yeast chromosome XIII that complements pet G199 mutants (COX7) and carries a new non-essential gene

The mutants of Saccharomyces cerevisiae assigned to complementation group G199 are deficient in mitochondrial respiration and lack a functional cytochrome oxidase complex. Recombinant plasmids capable of restoring respiration were cloned by transformation of mutants of this group with a yeast genomic library. Sequencing indicated that a 2.1-kb subclone encompasses the very end (last 11 amino acids) of the PET111 gene, the COX7 gene and a new gene (YMR255W) of unknown function that potentially codes for a polypeptide of 188 amino acids (about 21.5 kDa) without significant homology to any known protein. We have shown that the respiratory defect corresponding to group G199 is complemented by plasmids carrying only the COX7 gene. The gene YMR255W was inactivated by one-step gene replacement and the disrupted strain was viable and unaffected in its ability to grow in a variety of different test media such as minimal or complete media using eight distinct carbon sources at three pH values and temperatures. Inactivation of this gene also did not affect mating or sporulation

Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α

A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.

New microsatellite markers developed from an enriched microsatellite common bean library

The objective of this work was to develop new microsatellite markers in common bean. Ninety nine new microsatelitte loci were developed from a microsatellite enriched library for (CT)8 and (GT)8 motifs, from CAL-143 line. The majority of microsatellite sequences (51%) was related to cellular metabolism. The remaining sequences were associated to transcription functions. Only 17.2% of the sequences presented some level of similarity with other plant species genes.

Technology and research in a global Networked University Digital Library (NUDL)

Digital Libraries (DLs) are extremely complex information systems that support the creation, management, distribution, and preservation of complex information resources, while allowing effective and efficient interaction among the several societies that benefit from DL content and services. In this paper, we focus on our experience facing challenges of building, maintaining, and developing the Networked University Digital Library (www.nudl.org), an extension of the Networked Digital Library of Theses and Dissertations (www.ndltd.org). NUDL is a worldwide initiative that addresses making the intellectual property produced in universities more accessible, stimulating international collaboration across all disciplines. We detail technological aspects of our solutions and research activities carried out to provide powerful and enriched services for the communities served by this initiative.

A microsatellite library for Carica papaya L. cv. Sunrise solo

In experimental areas of the Education and Researches Ilha Solteira and Jaboticabal UNESP/Campus farms were selected and tagged 20 hermaphrodite plants and 20 feminine of cultivar Sunrise Solo, Improved Sunrise Solo cv.72/12 and Baixinho of Santa Amália.The seeds origined of the selected fruits were cropped to be analysed the self-pollination efficiency and frequency of the sex in the progenies. After that, samples of the young leaf of the matrix plants were colected for the extration of the DNA. It was built five library enriched of microsatellite sequencies, using probes (TCA)10, (TC)13, (GATA)4, (CAC)10 e (TGAG)8.It was possible the development of the primers only in the library that has utilized the probe (TCA)10. This probe allowed the design of 32 primer pairs. From these, 31 presented pattern of unique band in agarose Metaphor and in acrilamide. For primer S36 were observed 2 bands, but with no polymorphism to differentiation in the sexual form at papaya tree culture. However, these primers can be tested, in the futures, in the investigation of the others features in segregated populations of this specie and the related species, germoplasm analysis, cultivars identification, parent evolution and molecular markers for the assisted plant breeding programs.

Breeding, genetic and genomic of citrus for disease resistance

Although the citriculture is one of the most important economic activities in Brazil, it is based on a small number of varieties. This fact has contributed for the vulnerability of the culture regarding the phytosanitary problems. A higher number of varieties/genotypes with potential for commercial growing, either for the industry or fresh market, has been one of the main objectives of citrus breeding programs. The genetic breeding of citrus has improved, in the last decades, due to the possibility of an association between biotechnological tools and classical methods of breeding. The use of molecular markers for early selection of zygotic seedlings from controlled crosses resulted in the possibility of selection of a high number of new combination and, as a consequence, the establishment of a great number of hybrids in field experiments. The faster new tools are incorporated in the program, the faster is possibility to reach new genotypes that can be tested as a new variety. Good traits should be kept or incorporate, whereas bad traits have to be excluded or minimized in the new genotype. Scion and rootstock can not be considered separately, and graft compatibility, fruit quality and productivity are essential traits to be evaluated in the last stages of the program. The mapping of QTLs has favored breeding programs of several perennial species and in citrus it was possible to map several characteristics with qualitative and quantitative inheritance. The existence of linkage maps and QTLs already mapped, the development of EST and BAC library and the sequencing of the Citrus complete genome altogether make very demanding and urgent the exploration of such data to launch a wider genetic study of citrus. The rising of information on genome of several organisms has opened new approaches looking for integration between breeding, genetic and genome. Genome assisted selection (GAS) involves more than gene or complete genome sequencing and is becoming an import support in breeding programs of annual and perennial species. An huge information amount can be derivate from genome analysis. The use and benefit of such informations will depend on the genetic basis of the breeding program.

Genomic characterization of adenovirus serotype 7 isolated in Brazil from acute respiratory disease patients during the period from 1980 to 1991

Forty isolates of adenovirus type 7 were analized by restriction enzyme digestion with BamHI, SmaI, EcoRI and HindIII. These isolates were obtained from acute respiratory disease patients during the years 1980 to 1991. Only two genomic types were found: Ad7b and Ad7e, with Ad7b (87.5%) being more frequent than Ad7e (12.5%). The genomic type Ad7e appeared in the years 1980, 1981 and 1983. Ad7b appeared in 1982 and it was the only genomic type found from 1984 to 1991. Both genomic types were responsible for lower (LRTI) and upper (URTI) respiratory tract infection, but the proportion LRTI/URTI is higher for Ad7b (25/6) than for Ad7e (1/4).