69 resultados para Consensus Sequence


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P<0.0001). Moreover,FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs=0.317, P=0.006), hemoglobin levels (rs=0.210, P=0.049), and percentage of peripheral blood blasts (rs=0.256, P=0.027), but inversely correlated with hemoglobin levels in the control group (rs=–0.391, P<0.0001). AML patients with high CD34+ expression showed significantly higherFAMLF-CS expression than those with low CD34+ expression (P=0.041). Our results showed thatFAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The PyAG1 gene, identified by the screening of a Plasmodium yoelii genomic DNA library with a rhoptry-specific Mab, encodes a protein with a zinc finger structure immediately followed by the consensus sequence of the Arf GAP catalytic site. The serum of mice immunized with the recombinant protein recognized specifically the rhoptries of the late infected erythrocytic stages. Blast analysis using the Genbank database gave the highest scores with four proteins presenting an Arf1 GAP activity. If presenting also this activity, the PyAG1 protein could be involved in the regulation of the secreted protein vesicular transport and, consequently, in the rhoptry biogenesis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Bovine coronavirus (BCoV) causes severe diarrhea in newborn calves, is associated with winter dysentery in adult cattle and respiratory infections in calves and feedlot cattle. The BCoV S protein plays a fundamental role in viral attachment and entry into the host cell, and is cleaved into two subunits termed S1 (amino terminal) and S2 (carboxy terminal). The present study describes a strategy for the sequencing of the BCoV S1 gene directly from fecal diarrheic specimens that were previously identified as BCoV positive by RT-PCR assay for N gene detection. A consensus sequence of 2681 nucleotides was obtained through direct sequencing of seven overlapping PCR fragments of the S gene. The samples did not undergo cell culture passage prior to PCR amplification and sequencing. The structural analysis was based on the genomic differences between Brazilian strains and other known BCoV from different geographical regions. The phylogenetic analysis of the entire S1 gene showed that the BCoV Brazilian strains were more distant from the Mebus strain (97.8% identity for nucleotides and 96.8% identity for amino acids) and more similar to the BCoV-ENT strain (98.7% for nucleotides and 98.7% for amino acids). Based on the phylogenetic analysis of the hypervariable region of the S1 subunit, these strains clustered with the American (BCoV-ENT, 182NS) and Canadian (BCQ20, BCQ2070, BCQ9, BCQ571, BCQ1523) calf diarrhea and the Canadian winter dysentery (BCQ7373, BCQ2590) strains, but clustered on a separate branch of the Korean and respiratory BCoV strains. The BCoV strains of the present study were not clustered in the same branch of previously published Brazilian strains (AY606193, AY606194). These data agree with the genealogical construction and suggest that at least two different BCoV strains are circulating in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper analyzes People's Republic of China (PRC) economic and political ascendance in the 21st century focusing on the evolution of the sui generis economic development model and its significances of the evolution of relationship between China and the developing countries in the peripheral "Global South." The objective of this article is to analyze the relationship between China and the Global South (Africa and South America) in the 21st century, characterized as a new Center-periphery global network power based on trade and investment that we call as "Asian Consensus."

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds) with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context and objective:The molecular characterization of local isolates of Toxoplasma gondii is considered significant so as to assess the homologous variations between the different loci of various strains of parasites.Design and setting:The present communication deals with the molecular cloning and sequence analysis of the 1158 bp entire open reading frame (ORF) of surface antigen 3 (SAG3) of two Indian T. gondii isolates (Chennai and Izatnagar) being maintained as cryostock at the IVRI.Method:The surface antigen 3 (SAG3) of two local Indian isolates were cloned and sequenced before being compared with the available published sequences.Results:The sequence comparison analysis revealed 99.9% homology with the standard published RH strain sequence of T. gondii. The strains were also compared with other established published sequences and found to be most related to the P-Br strain and CEP strain (both 99.3%), and least with PRU strain (98.4%). However, the two Indian isolates had 100% homology between them.Conclusion:Finally, it was concluded that the Indian isolates were closer to the RH strain than to the P-Br strain (Brazilian strain), the CEP strain and the PRU strains (USA), with respect to nucleotide homology. The two Indian isolates used in the present study are known to vary between themselves, as far as homologies related to other genes are concerned, but they were found to be 100% homologous as far as SAG3 locus is concerned. This could be attributed to the fact that this SAG3 might be a conserved locus and thereby, further detailed studies are thereby warranted to exploit the use of this particular molecule in diagnostics and immunoprophylactics. The findings are important from the point of view of molecular phylogeny.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the present report we describe the results from a pilot study aimed at detecting enterovirus sequence in cardiac tissues, obtained through endomyocardial biopsies, from patients suffering from cardiac diseases in the Amazon region. Six samples that were collected from three patients were analysed by RT-PCR showing 3 positive and 3 negative results. These preliminary findings suggest the participation of enteroviruses in the etiology of cardiac diseases, mainly myocarditis, and warrant further and broader local studies on this subject.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Amino acid insertions in the protease have rarely been described in HIVinfected patients. One of these insertions has recently been described in codon 35, although its impact on resistance remains unknown. This study presents a case of an HIV variant with an insertion in codon 35 of the protease, described for the first time in Bauru, State of Sao Paulo, Brazil, circulating in a 38-year-old caucasian male with asymptomatic HIV infection since 1997. The variant isolated showed a codon 35 insertion of two amino acids in the protease: a threonine and an aspartic acid, resulting in the amino acid sequence E35E_TD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have isolated a clone of Trypanosoma cruzi genimic DNA, lambda 3b2-5, which contains sequences that are reiterated in the genome. Northtern blot analysis showed that clone 3b2-5 hybridizes to 1,200-5,000 bases different mRNA species. The number of mRNAs species hybridized to clone 3b2-5 exceeds its coding capacity showing that this clone carries sequences that are common to several mRNAs species and conserved in the poly A(+) RNA. These sequences are not homologous to the T. cruzi spliced leader sequence, since clone 3b2-5 hybridize to a synthetic 20 nucleotice complementary to the spliced leader sequence. Clone 3b2-5 does not hybridize to DNA and RNA from several genera of Trypanosomatidae and other Trypanosoma species indicating that it carries T. cruzi species-specific sequences.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tandemly repeated DNA sequences are found in the genome of higher eukaryotes, and have also been demonstrated in Trypanosoma cruzi. Repeated DNA sequences are potentially useful for the diagnostic detection of T. cruzi (A. Gonzales et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 3356-3360). We have isoleted two clones from a genomic library of T. cruzi (Y strain) that contain, in one clone a family of at least seven copies of a repetitive sequence of approximately 600 base pairs, and in the other an independent copy of the same sequence. One copy of the repetition (HSP) and the independent clone (HCR) were sequenced by the Sanger procedure (Fig.). This sequence hybridized to four strains of T. cruzi tested and did not hybridize to eleven species of trypanosotids from five different Genera, being a good candidate for diagnostic assays. GenBank accession numbers: HSP#m31919, HCR#31920.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The P126 protein, a parasitosphorus vacuole antigen of Plasmodium falciparum has beenshoen to induce protective immunity in Saimiri and Aotus monkeys. In the present work we investigated its immunogenicity. Our results suggest that the N-term of P126 is poorly immunogenic and antibody response against the P126 could be under a MHC restricted control in C57BL/6(H-2b) mice, which could be problematic in ternms of a use of the P126 in a vaccine program. However, we observed that a synthetic peptide, copying the 6 octapeptide repeat corresponding to the N-term of the P126, induces an antibody response to the native molecule in C57BL/6 non-responder mice. Moreover, the vaccine-P126 recombinant induced anmtibodies against the N-term of the molecule in rabbits while the unprocessed P126 did not.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Continuing the Schistosoma mansoni Genome Project 363 new templates were sequenced generating 205 more ESTs corresponding to 91 genes. Seventy four of these genes (81%) had not previously been described in S. mansoni. Among the newly discovered genes there are several of significant biological interest such as synaptophysin, NIFs-like and rho-GDP dissociation inhibitor