9 resultados para upstream activator sequence
em DigitalCommons@The Texas Medical Center
Resumo:
Borrelia burgdorferi, the Lyme disease spirochete, dramatically alters its transcriptome and proteome as it cycles between the arthropod vector and mammalian host. During this enzootic cycle, a novel regulatory network, the Rrp2-RpoN-RpoS pathway (also known as the σ(54)-σ(S) sigma factor cascade), plays a central role in modulating the differential expression of more than 10% of all B. burgdorferi genes, including the major virulence genes ospA and ospC. However, the mechanism(s) by which the upstream activator and response regulator Rrp2 is activated remains unclear. Here, we show that none of the histidine kinases present in the B. burgdorferi genome are required for the activation of Rrp2. Instead, we present biochemical and genetic evidence that supports the hypothesis that activation of the Rrp2-RpoN-RpoS pathway occurs via the small, high-energy, phosphoryl-donor acetyl phosphate (acetyl∼P), the intermediate of the Ack-Pta (acetate kinase-phosphate acetyltransferase) pathway that converts acetate to acetyl-CoA. Supplementation of the growth medium with acetate induced activation of the Rrp2-RpoN-RpoS pathway in a dose-dependent manner. Conversely, the overexpression of Pta virtually abolished acetate-induced activation of this pathway, suggesting that acetate works through acetyl∼P. Overexpression of Pta also greatly inhibited temperature and cell density-induced activation of RpoS and OspC, suggesting that these environmental cues affect the Rrp2-RpoN-RpoS pathway by influencing acetyl∼P. Finally, overexpression of Pta partially reduced infectivity of B. burgdorferi in mice. Taken together, these findings suggest that acetyl∼P is one of the key activating molecule for the activation of the Rrp2-RpoN-RpoS pathway and support the emerging concept that acetyl∼P can serve as a global signal in bacterial pathogenesis.
Resumo:
PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^
Resumo:
The adenovirus type 5 E1A gene products have numerous functions in cells, which serve as useful tools in studying the mechanisms of either oncogenesis or tumor suppression. To understand the mechanisms of E1A-mediated tumor suppression, we introduced an Ad5 E1A gene into murine melanoma cells, and characterized E1A-mediated biological functions both in vitro and in vivo. The results of the study indicated that: (i) Ad5 E1A mediated tumor suppression in rodent tumor cells; (ii) E1A-mediated tumor suppression is associated with E1A-mediated apoptosis in vivo.^ To determine which functional region(s) of E1A is(are) required for E1A-mediated apoptosis and whether E1A-mediated apoptosis is required for E1A-mediated tumor suppression, we established stable transfectants of E1A mutants, which have deletion mutation at either the N-terminal (p300-binding) or the CR2 (pRb-binding) domain or both, and then characterized biological functions both in vitro and in vivo. The results of the study indicate that the CR2 domain of E1A is required for E1A-mediated apoptosis, while the N-terminal domain of E1A is dispensable. Interestingly, either of the two domains is able to mediate tumor suppression, since mutant E1A with a single deletion at either domain still suppressed tumor growth. Importantly, deletion mutations at both the N-terminal and the CR2 domains of E1A abrogated E1A-mediated tumor suppression, suggesting both regions are required for E1A-mediated tumor suppression. The results demonstrate that E1A-mediated apoptosis is not the only mechanism for E1A-mediated tumor suppression. Thus, the N-terminal and CR2 domains of E1A mediated two independent mechanisms of tumor suppression.^ To understand the mechanism of E1A-mediated apoptosis, we examined the temporal relationship of molecular events during the apoptotic cascades after UV radiation and serum depletion in both the E1A-expressing cells and parental cells. Kinetic analysis of JNK activity indicates that the JNK pathway is greatly increased in response to UV light in E1A transfectants, suggesting that extracellular stress stimuli have been converted into intracellular stress signals with greater magnitude in E1A transfectants than those in parental cells. Thus, E1A-mediated sensitization precedes these events. As ceramide has been proposed as second messenger and upstream activator of JNK pathway for stress-induced apoptosis, we also examined the roles of ceramide in apoptosis and the relationship with JNK pathway. The results indicate that E1A transfectants do not have increased sensitivity to ceramide. Therefore, E1A-mediated sensitization to UV radiation cannot be attributed to an increased sensitivity to ceramide. Furthermore, UV-induced JNK activation correlates with UV-induced apoptosis, while lethal dose of ceramide does not activate JNK. Thus, activation of JNK pathway is independent of the ceramide pathway. In addition, E1A transfectants also have increased activation of NF-kB in response to UV. These results suggest that E1A-mediated sensitization is an early event which associates with conversion of extracellular stress stimuli into amplified intracellular signals. The mechanism of E1A-mediated sensitization and its relationship with other pathways are discussed. ^
Resumo:
The FsrABC system of Enterococcus faecalis controls the expression of gelatinase and a serine protease via a quorum-sensing mechanism, and recent studies suggest that the Fsr system may also regulate other genes important for virulence. To investigate the possibility that Fsr influences the expression of additional genes, we used transcriptional profiling, with microarrays based on the E. faecalis strain V583 sequence, to compare the E. faecalis strain OG1RF with its isogenic mutant, TX5266, an fsrB deletion mutant. We found that the presence of an intact fsrB influences expression of numerous genes throughout the growth phases tested, namely, late log to early stationary phase. In addition, the Fsr regulon is independent of the activity of the proteases, GelE and SprE, whose expression was confirmed to be activated at all three time points tested. While expression of some genes (i.e., ef1097 and ef0750 to -757, encoding hypothetical proteins) was activated in late log phase in OG1RF versus the fsrB deletion mutant, expression of ef1617 to -1634 (eut-pdu orthologues) was highly repressed by the presence of an intact Fsr at entry into stationary phase. This is the first time that Fsr has been characterized as a negative regulator. The newly recognized Fsr-regulated targets include other factors, besides gelatinase, described as important for biofilms (BopD), and genes predicted to encode the surface proteins EF0750 to -0757 and EF1097, along with proteins implicated in several metabolic pathways, indicating that the FsrABC system may be an important regulator in strain OG1RF, with both positive and negative effects.
Resumo:
Lyme disease is a multisystemic disorder caused by tick-borne infection of humans or other mammalian hosts with Borrelia burgdorferi. If untreated, the spirochetes can persist in the mammalian host for months or years. The mechanisms by which Lyme disease spirochetes evade the immune response have not been determined. In this study, we have identified and characterized an elaborate genetic system in the Lyme disease spirochete B. burgdorferi that promotes extensive antigenic variation of a 34-kDa surface-exposed lipoprotein, VlsE. A 28-kilobase linear plasmid of B. burgdorferi B31 (lp28-1) was found to contain a vmp-like sequence (vls) locus that closely resembles the variable major protein (vmp) system for antigenic variation of relapsing fever organisms. The presence of lp28-1 correlates with the high-infectivity phenotype in B. burgdorferi strains tested. Segments of the 15 non-expressed (silent) vls cassette sequences located upstream of vlsE are able to recombine into the centra vlsE cassette region during infection of C3H/HeN mice, resulting in antigenic variation of the expressed lipoprotein. When compared to parental VlsE, VlsE variants progressively accumulate sequence changes during the period of 4, 7, 14, 21, and 28 days post infection in C3H/HeN mice. However, no recombination was detected during the period of 28-day in vitro culture, suggesting in vivo induction of VlsE antigenic variation. Adaptive immune responses do not appear to play a significant role in this induction, since similar recombination events were also observed in immunodeficient SCID mice. The $5\sp\prime$ and $3\sp\prime$ noncassette regions of vlsE are apparently not subject to recombination and sequence variation. The structure and sequence of the silent vls cassette locus is preserved during the process of the VlsE antigenic variation, consistent with a nonreciprocal recombination mechanism. This combinatorial form of antigenic variation could potentially yield millions of VlsE variants in the mammalian host, and thereby contribute to immune evasion, long-term survival, and pathogenesis of B. burgdorferi. ^
Resumo:
Hematopoietic growth factors play important roles in regulating blood cell growth and development in vivo. In this work, we investigated the signaling mechanisms of two growth factors with clinical significance, erythropoietin (Epo) and granulocyte colony-stimulating factor (G-CSF). Epo is essential for the survival, proliferation and differentiation of red blood cell progenitors, while G-CSF plays an important role in controlling mature neutrophil production. To identify which amino acid(s) and/or motif in EpoR is responsible for cell survival, wild type or mutant EpoR isoforms were transfected into the growth factor-dependent 32D cell line. Proliferation and apoptosis assays demonstrated that an EpoR isoform that lacks intracellular tyrosine residues and is truncated after 321 amino acids in the cytoplasmic tail (EpoR 1-321) mediates Epo-dependent cell survival. Furthermore, in absence of fetal calf serum (FCS), Epo signaling through wild type or mutant receptors supported anti-apoptosis, but not proliferation during 72 hours in response to Epo. To investigate the signaling pathway by which EpoR regulates cell survival, a dominant negative Stat5b (dnStat5b) isoform was generated and coexpressed with EpoR in stable cell lines. Expression of dnStat5b causes a significant induction of apoptosis in the presence of Epo in cells expressing EpoR 1-321, indicating that Stat5 is essential for survival signaling through tyrosine independent sequences in the EpoR. In a second project to investigate G-CSF signaling, we studied mechanisms by which G-CSF regulates the expression of PU.1, an important transcription factor in myeloid and B cell development. We demonstrated, by immunoblot and real time RT-PCR, that PU.1 is induced by G-CSF ex vivo as well as in vivo. To test whether G-CSF signaling through Stat3 is required for PU.1 regulation, the upstream region of the PU.1 gene was analyzed for potential Stat3 binding motifs. Four potential sites were identified; chromatin immunoprecipitations demonstrated that G-CSF activated Stat3 binds to 3 of the 4 binding motifs. In addition, PU.1 induction by G-CSF was completely abrogated in bone marrow from hematopoietic conditional Stat3 knockout mice. These results indicate an important role for Stat3 in G-CSF-dependent PU.1 gene regulation. Collectively, our works demonstrate that Stat protein play important and diverse roles in hematopoietic growth factor signaling. ^
Resumo:
The POU domain transcription factor Brn3b/POU4F2 plays a critical role regulating gene expression in mouse retinal ganglion cells (RGCs). Previous investigations have shown that Brn3b is not required for initial cell fate specification or migration; however, it is essential for normal RGC differentiation. In contrast to wild type axons, the mutant neurites were phenotypically different: shorter, rougher, disorganized, and poorly fasciculated. Wild type axons stained intensely with axon specific marker tau-1, while mutant projections were weakly stained and the mutant projections showed strong labeling with dendrite specific marker MAP2. Brn-3b mutant axonal projections contained more microtubules and fewer neurofilaments, a dendritic characteristic, than the wild type. The mutant neurites also exhibited significantly weaker staining of neurofilament low-molecular-weight (NF-L) in the axon when compared to the wild type, and NF-L accumulation in the neuron cell body. The absence of Brn-3b results in an inability to form normal axons and enhanced apoptosis in RGCs, suggesting that Brn-3b may control a set of genes involved in axon formation. ^ Brn3b contains several distinct sequence motifs: a glycine/serine rich region, two histidine rich regions, and a fifteen amino acid conserved sequence shared by all Brn3 family members in the N-terminus and a POU specific and POU homeodomain in the C-terminus. Brn3b activates a Luciferase reporter over 25 fold in cell culture when binding to native brn3 binding sites upstream of a minimal promoter. When fused to the Gal4 DNA Binding domain (DBD) and driven by either a strong (CMV) or weaker (pAHD) promoter, the N-terminal of Brn3b is capable of similar activation when binding to Gal4 UAS sites, indicating a presumptive activator of transcription. Both full length Brn3b or the C-terminus fused to the Gal4DBD and driven by pCMV repressed a Luciferase reporter downstream of UAS binding sites. Lower levels of expression of the fusion protein driven by pADH resulted in an alleviation of repression. This repression appears to be a limitation of this system of transcriptional analysis and a potential pitfall in conventional pCMV based transfection assays. ^
Resumo:
p53 is a tumor suppressor gene that is the most frequent target inactivated in cancers. Overexpression of wild-type p53 in rat embryo fibroblasts suppresses foci formation by other cooperating oncogenes. Introduction of wild-type p53 into cells that lack p53 arrests them at the G1/S boundary and reverses the transformed phenotype of some cells. The function of p53 in normal cells is illustrated by the ability of p53 to arrest cells at G1 phase of the cell cycle upon exposure to DNA-damaging agents including UV-irradiation and biosynthesis inhibitors.^ Since the amino acid sequence of p53 suggested that it may function as a transcription factor, we used GAL4 fusion assays to test that possibility. We found that wild-type p53 could specifically activate transcription when anchored by the GAL4 DNA binding domain. Mutant p53s, which have lost the ability to suppress foci formation by other oncogenes, were not able to activate transcription in this assay. Thus, we established a direct correlation between the tumor suppression and transactivation functions of p53.^ Having learned that p53 was a transcriptional activator, we next sought targets of p53 activation. Because many transcription factors regulate their own expression, we tested whether p53 had this autoregulatory property. Transient expression of wild-type p53 in cells increased the levels of endogenous p53 mRNA. Cotransfection of p53 together with a reporter bearing the p53 promoter confirmed that wild-type p53 specifically activates its own promoter. Deletion analysis from both the 5$\sp\prime$ and 3$\sp\prime$ ends of the promoter minimized the region responsible for p53 autoregulation to 45 bp. Methylation interference identified nucleotides involved in protein-DNA interaction. Mutations within this protected site specifically eliminated the response of the promoter to p53. In addition, multiple copies of this element confer responsiveness to wild-type p53 expression. Thus, we identified a F53 responsive element within the p53 promoter.^ The presence of a consensus NF-$\kappa$B site in the p53 promoter suggested that NF-KB may regulate p53 expression. Gel-shift experiments showed that both the p50 homodimer and the p50/p65 heterodimer bind to the p53 promoter. In addition, the p65 subunit of NF-$\kappa$B activates the p53 promoter in transient transfection experiments. TNF $\alpha$, a natural NF-$\kappa$B inducer, also activates the p53 promoter. Both p65 activation and TNF $\alpha$ induction require an intact NF-$\kappa$B site in the p53 promoter. Since NF-$\kappa$B activation occurs as a response to stress and p53 arrests cells in G1/S, where DNA repair occurs, activation of p53 by NF-$\kappa$B could be a mechanism by which cells recover from stress.^ In conclusion, we provided the first data that wild-type p53 functions as a transcriptional activator, whereas mutant p53 cannot. The correlation between growth suppression and transcriptional activation by p53 implies a pathway of tumor suppression. We have analyzed upstream components of the pathway by the identification of both p53 and NF-$\kappa$B as regulators of the p53 promoter. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^