Cis-acting elements and developmental regulators govern toxin gene expression in Bacillus anthracis

Expression of the structural genes for the anthrax toxin proteins is coordinately controlled by host-related signals such as elevated CO2 , and the trans-acting positive regulator, AtxA. No specific binding of AtxA to the toxin gene promoters has been demonstrated and no sequence-based similarities are apparent in the promoter regions of toxin genes. We hypothesized that the toxin genes possess common structural features that are required for positive regulation. To test this hypothesis, I performed an extensive characterization of the toxin gene promoters. I determined the minimal sequences required for atxA-mediated toxin gene expression and compared these sequences for structural similarities. In silico modeling and in vitro experiments indicated significant curvature within these regions. Random mutagenesis revealed that point mutations associated with reduced transcriptional activity, mostly mapped to areas of high curvature. This work enabled the identification of two potential cis-acting elements implicated in AtxA-mediated regulation of the toxin genes. In addition to the growth condition requirements and AtxA, toxin gene expression is under growth phase regulation. The transition state regulator AbrB represses atxA expression to influence toxin synthesis. Here I report that toxin gene expression also requires sigH, a gene encoding the RNA polymerase sigma factor associated with development in B. subtilis. In the well-studied B. subtilis system, σH is part of a feedback control pathway that involves AbrB and the major response regulator of sporulation initiation, Spo0A. My data indicate that in B. anthracis, regulatory relationships exist between these developmental regulators and atxA . Interestingly, during growth in toxin-inducing conditions, sigH and abrB expression deviates from that described for B. subtilis, affecting expression of the atxA gene. These findings, combined with previous observations, suggest that the steady state level of atxA expression is critical for optimal toxin gene transcription. I propose a model whereby, under toxin-inducing conditions, control of toxin gene expression is fine-tuned by the independent effects of the developmental regulators on the expression of atxA . The growth condition-dependent changes in expression of these regulators may be crucial for the correct timing and uninterrupted expression of the toxin genes during infection. ^

Pilot study assessment of indoor air quality in two dental settings: Particulate matter and volatile organic compounds

Objective: To assess the indoor environment of two different types of dental practices regarding VOCs, PM2.5, and ultrafine particulate concentrations and examine the relationship between specific dental activities and contaminant levels. Method: The indoor environments of two selected dental settings (private practice and community health center) will were assessed in regards to VOCs, PM 2.5, and ultrafine particulate concentrations, as well as other indoor air quality parameters (CO2, CO, temperature, and relative humidity). The sampling duration was four working days for each dental practice. Continuous monitoring and integrated sampling methods were used and number of occupants, frequency, type, and duration of dental procedures or activities recorded. Measurements were compared to indoor air quality standards and guidelines. Results: The private practice had higher CO2, CO, and most VOC concentrations than the community health center, but the community health center had higher PM2.5 and ultrafine PM concentrations. Concentrations of p-dichlorobenzene and PM2.5 exceeded some guidelines. Outdoor concentrations greatly influenced the indoor concentration. There were no significant differences in contaminant levels between the operatory and general area. Indoor concentrations during the working period were not always consistently higher than during the nonworking period. Peaks in particulate matter concentration occurred during root canal and composite procedures.^

Perfusion in rat brain at 7 T with arterial spin labeling using FAIR-TrueFISP and QUIPSS.

Measurement of perfusion in longitudinal studies allows for the assessment of tissue integrity and the detection of subtle pathologies. In this work, the feasibility of measuring brain perfusion in rats with high spatial resolution using arterial spin labeling is reported. A flow-sensitive alternating recovery sequence, coupled with a balanced gradient fast imaging with steady-state precession readout section was used to minimize ghosting and geometric distortions, while achieving high signal-to-noise ratio. The quantitative imaging of perfusion using a single subtraction method was implemented to address the effects of variable transit delays between the labeling of spins and their arrival at the imaging slice. Studies in six rats at 7 T showed good perfusion contrast with minimal geometric distortion. The measured blood flow values of 152.5+/-6.3 ml/100 g per minute in gray matter and 72.3+/-14.0 ml/100 g per minute in white matter are in good agreement with previously reported values based on autoradiography, considered to be the gold standard.

Exon involvement in the regulation of MuSVts110 RNA splicing

MuSVts110 is a conditionally defective mutant of Moloney murine sarcoma virus which undergoes a novel tmperature-dependent splice event at growth temperatures of 33$\sp\circ$C or lower. Relative to wild-type MuSV-124, MuSVts110 contains a 1487 base deletion spanning from the 3$\sp\prime$ end of the p30 gag coding region to just downstream of the first v-mos initiation codon. As a result, the gag and mos genes are fused out of frame and no v-mos protein is expressed. However, upon a shift to 33$\sp\circ$C or lower, a splice event occurs which removes 431 bases, realigns the gag and mos genes, and allows read-through translation of a P85gag-mos transforming protein. Interestingly, while the cryptic splice sites utilized in MuSVts110 are present and unaltered in MuSV-124, they are never used. Due to the 1487 base deletion, the MuSV-124 intron was reduced from 1919 to 431 bases suggesting that intron size might be involved in the activation of these cryptic splice sites in MuSVts110. Since the splicing phenotype of the MuSVts110 equivalent (TS32 DNA) which contains the identical 1487 base deletion introduced into otherwise wild-type MuSV-124 DNA, was indistinguishable from authentic MuSVts110, it was concluded that this deletion alone is responsible for activation of the cryptic splice sites used in MuSVts110. These results also confirmed that thermodependent splicing is an intrinsic property of the viral RNA and not due to some cellular defect. Furthermore, analysis of gag gene deletion and frameshift MuSVts110 mutants demonstrated that viral gag gene proteins do not play a role in regulation of MuSVts110 splicing. Instead, cis-acting viral sequences appear to mediate regulation of the splice event.^ Our initial observation that truncation of the MuSVts110 transcript, leaving only residual amounts of the flanking exon sequences, completely abolished splicing activity argued that exon sequences might participate in the regulation of the splice event.^ Analysis of exon sequence involvement has also identified cis-acting sequences important in the thermodependence of the splice event. Data suggest that regulation of the MuSVts110 splice event involves multiple interactions between specific intron and exon sequences and spliceosome components which together limit splicing activity to temperatures of 33$\sp\circ$C or lower while simultaneously restricting splicing to a maximum of 50% efficiency. (Abstract shortened with permission of author.) ^

Diffusion tensor imaging of rat spinal cord in vivo

Magnetic resonance imaging, with its exquisite soft tissue contrast, is an ideal modality for investigating spinal cord pathology. While conventional MRI techniques are very sensitive for spinal cord pathology, their specificity is somewhat limited. Diffusion MRI is an advanced technique which is a very sensitive and specific indicator of the integrity of white matter tracts. Diffusion imaging has been shown to detect early ischemic changes in white matter, while conventional imaging demonstrates no change. By acquiring the complete apparent diffusion tensor (ADT), tissue diffusion properties can be expressed in terms of quantitative and rotationally invariant parameters. ^ Systematic study of SCI in vivo requires controlled animal models such as the popular rat model. To date, studies of spinal cord using ADT imaging have been performed exclusively in fixed, excised spinal cords, introducing inevitable artifacts and losing the benefits of MRI's noninvasive nature. In vivo imaging reflects the actual in vivo tissue properties, and allows each animal to be imaged at multiple time points, greatly reducing the number of animals required to achieve statistical significance. Because the spinal cord is very small, the available signal-to-noise ratio (SNR) is very low. Prior spin-echo based ADT studies of rat spinal cord have relied on high magnetic field strengths and long imaging times—on the order of 10 hours—for adequate SNR. Such long imaging times are incompatible with in vivo imaging, and are not relevant for imaging the early phases following SCI. Echo planar imaging (EPI) is one of the fastest imaging methods, and is popular for diffusion imaging. However, EPI further lowers the image SNR, and is very sensitive to small imperfections in the magnetic field, such as those introduced by the bony spine. Additionally, The small field-of-view (FOV) needed for spinal cord imaging requires large imaging gradients which generate EPI artifacts. The addition of diffusion gradients introduces yet further artifacts. ^ This work develops a method for rapid EPI-based in vivo diffusion imaging of rat spinal cord. The method involves improving the SNR using an implantable coil; reducing magnetic field inhomogeneities by means of an autoshim, and correcting EPI artifacts by post-processing. New EPI artifacts due to diffusion gradients described, and post-processing correction techniques are developed. ^ These techniques were used to obtain rotationally invariant diffusion parameters from 9 animals in vivo, and were validated using the gold-standard, but slow, spinecho based diffusion sequence. These are the first reported measurements of the ADT in spinal cord in vivo . ^ Many of the techniques described are equally applicable toward imaging of human spinal cord. We anticipate that these techniques will aid in evaluating and optimizing potential therapies, and will lead to improved patient care. ^

Mapping and characterization of the Xlsirt P11 RNA cis-acting localization element

In many organisms, polarity of the oocyte is established post-transcriptionally via subcellular RNA localization. Many RNAs are localized during oogenesis in Xenopus laevis, including Xlsirts ( Xenopus laevis short interspersed repeat transcripts) [Kloc, 1993]. Xlsirts constitute a large family defined by highly homologous repeat units 79–81 nucleotides in length. Endogenous Xlsirt RNAs use the METRO (Message Transport Organizer) pathway of localization, where RNAs are transported from the nucleus to the mitochondrial cloud in stage I oocytes. Secondly, RNAs anchor at the vegetal pole in stage II oocytes. Exogenous Xlsirt RNAs can also utilize the Late pathway of localization, which involves localization to the vegetal cortex during stage III of oogenesis and results in RNAs anchored in the cortex of the entire vegetal hemisphere. ^ The Xlsirts localization signal is contained within the repeat region. This study was designed to test the hypothesis that there are cis -acting localization elements in Xlsirts, and that higher order structure plays a role. Results of experiments on Xlsirt P11, a 1700 basepair (bp) family member, led to the conclusion that a 137-bp fragment of the repetitive region is necessary and sufficient for METRO and Late pathway localization. This analysis definitively demonstrates that the Xlsirt localization signal for the METRO and Late pathways reside within the repetitive region and not within the flanking regions. Analysis of Xlsirt linker scanning mutations revealed two METRO-pathway specific subelements, and one Late-pathway specific subelement. Functional, computer, and biochemical evidence relates the higher order structure of this element to its ability to function as a localization element. ^ Xlsirt 137 is 99% identical to the Xlsirt consensus sequence identified in this study, suggesting that it is the localization element for all localized Xlsirt family members. The repeat unit was reframed based on function, rather than arbitrarily based on sequence. This work supports the hypothesis presented in 1981 by George Spohr, who originally isolated the Xlsirts, which stated that the highly conserved repetitive elements must be constrained from variability due to some unknown function of the repeats themselves. These studies shed light on the mechanism of RNA localization, linking structure and function. ^

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Mechanisms of HER2/{\it neu\/} proto-oncogene overexpression in breast cancer cells

Overexpression and amplification of HER2/neu have been documented in many primary tumors, most notably in breast. Not only do approximately 30% of breast cancer patients carry tumors that overexpress the gene, but those that do generally have shorter overall and disease-free survival times than patients with tumors expressing low levels of HER2/neu. Thus, overexpression of HER2/neu plays an important role in the pathogenesis of breast cancer. We have examined the mechanisms that result in HER2/neu overexpression in breast cancer by using, as a model system, established breast cancer cell lines that express much higher levels of HER2/neu mRNA than normal breast tissue while maintaining a near normal HER2/neu gene copy number. Nuclear run-on experiments indicate that the breast cancer cell lines MDA-MB453, BT483, and BT474 have an increased HER2/neu gene transcription rate. By using HER2/neu promoter-CAT constructs, we have found that the enhanced HER2/neu transcription rate in MDA-MB453 cells is due to activation of the gene in trans, while the enhanced transcription rate in BT483 cells is due to activation of the gene in either trans or cis. In BT474 cells, transcriptional upregulation is primarily due to gene amplification. Since the levels of increased transcription are not as high as the levels of HER2/neu mRNA in any of these three lines, post-transcriptional deregulation that increases HER2/neu expression must also be functioning in these cells. The half-life of HER2/neu mRNA was measured and found to be equivalent in these lines as in a control. Thus, the post-transcriptional deregulation is not increased stability of the HER2/neu transcript.^ Much work has been performed in characterizing the altered trans-acting factor involved in increased HER2/neu transcription in MDA-MB453 cells. Using promoter deletion constructs linked to a reporter gene, the region responsive to this factor was localized in the rat neu promoter. When human HER2/neu promoter constructs were used, the homologous sequence in the human promoter was identified. Furthermore, a number of protein/DNA complexes are detected when these promoter regions are used in gel mobility shift assays. UV-crosslinking experiments indicate DNA-binding proteins of roughly 110 kDa, 70 kDa, and 35 kDa are capable of interacting with the human promoter element. ^

Diffusion tensor imaging of cocaine-treated rodents.

Studies in cocaine-dependent human subjects have shown differences in white matter on diffusion tensor imaging (DTI) compared with non-drug-using controls. It is not known whether the differences in fractional anisotropy (FA) seen on DTI in white matter regions of cocaine-dependent humans result from a pre-existing predilection for drug use or purely from cocaine abuse. To study the effect of cocaine on brain white matter, DTI was performed on 24 rats after continuous infusion of cocaine or saline for 4 weeks, followed by brain histology. Voxel-based morphometry analysis showed an 18% FA decrease in the splenium of the corpus callosum (CC) in cocaine-treated animals relative to saline controls. On histology, significant increase in neurofilament expression (125%) and decrease in myelin basic protein (40%) were observed in the same region in cocaine-treated animals. This study supports the hypothesis that chronic cocaine use alters white matter integrity in human CC. Unlike humans, where the FA in the genu differed between cocaine users and non-users, the splenium was affected in rats. These differences between rodent and human findings could be due to several factors that include differences in the brain structure and function between species and/or the dose, timing, and duration of cocaine administration.

Transcriptional regulation of the invariant chain associated with MHC class II molecules

The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^