Dynamics of a minimal model of interlocked positive and negative feedback loops of transcriptional regulation by cAMP-response element binding proteins.

cAMP-response element binding (CREB) proteins are involved in transcriptional regulation in a number of cellular processes (e.g., neural plasticity and circadian rhythms). The CREB family contains activators and repressors that may interact through positive and negative feedback loops. These loops can be generated by auto- and cross-regulation of expression of CREB proteins, via CRE elements in or near their genes. Experiments suggest that such feedback loops may operate in several systems (e.g., Aplysia and rat). To understand the functional implications of such feedback loops, which are interlocked via cross-regulation of transcription, a minimal model with a positive and negative loop was developed and investigated using bifurcation analysis. Bifurcation analysis revealed diverse nonlinear dynamics (e.g., bistability and oscillations). The stability of steady states or oscillations could be changed by time delays in the synthesis of the activator (CREB1) or the repressor (CREB2). Investigation of stochastic fluctuations due to small numbers of molecules of CREB1 and CREB2 revealed a bimodal distribution of CREB molecules in the bistability region. The robustness of the stable HIGH and LOW states of CREB expression to stochastic noise differs, and a critical number of molecules was required to sustain the HIGH state for days or longer. Increasing positive feedback or decreasing negative feedback also increased the lifetime of the HIGH state, and persistence of this state may correlate with long-term memory formation. A critical number of molecules was also required to sustain robust oscillations of CREB expression. If a steady state was near a deterministic Hopf bifurcation point, stochastic resonance could induce oscillations. This comparative analysis of deterministic and stochastic dynamics not only provides insights into the possible dynamics of CREB regulatory motifs, but also demonstrates a framework for understanding other regulatory processes with similar network architecture.

Dynamics of a minimal model of interlocked positive and negative feedback loops of transcriptional regulation by cAMP-response element binding proteins.

cAMP-response element binding (CREB) proteins are involved in transcriptional regulation in a number of cellular processes (e.g., neural plasticity and circadian rhythms). The CREB family contains activators and repressors that may interact through positive and negative feedback loops. These loops can be generated by auto- and cross-regulation of expression of CREB proteins, via CRE elements in or near their genes. Experiments suggest that such feedback loops may operate in several systems (e.g., Aplysia and rat). To understand the functional implications of such feedback loops, which are interlocked via cross-regulation of transcription, a minimal model with a positive and negative loop was developed and investigated using bifurcation analysis. Bifurcation analysis revealed diverse nonlinear dynamics (e.g., bistability and oscillations). The stability of steady states or oscillations could be changed by time delays in the synthesis of the activator (CREB1) or the repressor (CREB2). Investigation of stochastic fluctuations due to small numbers of molecules of CREB1 and CREB2 revealed a bimodal distribution of CREB molecules in the bistability region. The robustness of the stable HIGH and LOW states of CREB expression to stochastic noise differs, and a critical number of molecules was required to sustain the HIGH state for days or longer. Increasing positive feedback or decreasing negative feedback also increased the lifetime of the HIGH state, and persistence of this state may correlate with long-term memory formation. A critical number of molecules was also required to sustain robust oscillations of CREB expression. If a steady state was near a deterministic Hopf bifurcation point, stochastic resonance could induce oscillations. This comparative analysis of deterministic and stochastic dynamics not only provides insights into the possible dynamics of CREB regulatory motifs, but also demonstrates a framework for understanding other regulatory processes with similar network architecture.

Comparison of OG1RF and an isogenic fsrB deletion mutant by transcriptional analysis: the Fsr system of Enterococcus faecalis is more than the activator of gelatinase and serine protease.

The FsrABC system of Enterococcus faecalis controls the expression of gelatinase and a serine protease via a quorum-sensing mechanism, and recent studies suggest that the Fsr system may also regulate other genes important for virulence. To investigate the possibility that Fsr influences the expression of additional genes, we used transcriptional profiling, with microarrays based on the E. faecalis strain V583 sequence, to compare the E. faecalis strain OG1RF with its isogenic mutant, TX5266, an fsrB deletion mutant. We found that the presence of an intact fsrB influences expression of numerous genes throughout the growth phases tested, namely, late log to early stationary phase. In addition, the Fsr regulon is independent of the activity of the proteases, GelE and SprE, whose expression was confirmed to be activated at all three time points tested. While expression of some genes (i.e., ef1097 and ef0750 to -757, encoding hypothetical proteins) was activated in late log phase in OG1RF versus the fsrB deletion mutant, expression of ef1617 to -1634 (eut-pdu orthologues) was highly repressed by the presence of an intact Fsr at entry into stationary phase. This is the first time that Fsr has been characterized as a negative regulator. The newly recognized Fsr-regulated targets include other factors, besides gelatinase, described as important for biofilms (BopD), and genes predicted to encode the surface proteins EF0750 to -0757 and EF1097, along with proteins implicated in several metabolic pathways, indicating that the FsrABC system may be an important regulator in strain OG1RF, with both positive and negative effects.

The performance of human papillomavirus high-risk DNA testing in the screening and diagnostic settings.

OBJECTIVE: We sought to evaluate the performance of the human papillomavirus high-risk DNA test in patients 30 years and older. MATERIALS AND METHODS: Screening (n=835) and diagnosis (n=518) groups were defined based on prior Papanicolaou smear results as part of a clinical trial for cervical cancer detection. We compared the Hybrid Capture II (HCII) test result with the worst histologic report. We used cervical intraepithelial neoplasia (CIN) 2/3 or worse as the reference of disease. We calculated sensitivities, specificities, positive and negative likelihood ratios (LR+ and LR-), receiver operating characteristic (ROC) curves, and areas under the ROC curves for the HCII test. We also considered alternative strategies, including Papanicolaou smear, a combination of Papanicolaou smear and the HCII test, a sequence of Papanicolaou smear followed by the HCII test, and a sequence of the HCII test followed by Papanicolaou smear. RESULTS: For the screening group, the sensitivity was 0.69 and the specificity was 0.93; the area under the ROC curve was 0.81. The LR+ and LR- were 10.24 and 0.34, respectively. For the diagnosis group, the sensitivity was 0.88 and the specificity was 0.78; the area under the ROC curve was 0.83. The LR+ and LR- were 4.06 and 0.14, respectively. Sequential testing showed little or no improvement over the combination testing. CONCLUSIONS: The HCII test in the screening group had a greater LR+ for the detection of CIN 2/3 or worse. HCII testing may be an additional screening tool for cervical cancer in women 30 years and older.

Determination of an inoculum effect with various cephalosporins among clinical isolates of methicillin-susceptible Staphylococcus aureus.

Using 98 clinical methicillin-susceptible Staphylococcus aureus isolates of known beta-lactamase (Bla) type, we found a pronounced inoculum effect for cephalexin (mostly Bla type A and C strains), a mild inoculum effect for cephalothin (especially types B and C), and no inoculum effects for ceftriaxone and cefuroxime. Ceftobiprole showed the lowest MICs at a high inoculum but with a slight increase for Bla-positive versus Bla-negative strains. Since a potential therapeutic effect associated with a cephalosporin inoculum effect has been described, further studies are warranted.

Integrins in human T cell function: Transdominant regulation, conformational constraints, and intracellular effectors

Integrin adhesion molecules have both positive and negative potential in the regulation of peripheral blood T cell (PB T cell) activation, yet their mechanism of action in the mediation of human T lymphocyte function remains largely undefined. The goals of this study then were to elucidate integrin signaling mechanisms in PB T cells.^ By ligating $\beta$1 integrins with mAb 18D3, it was demonstrated that costimulation of PB T cell proliferation induced by coimmobilizing antibodies specific for $\beta$1, $\beta$2, and $\beta$7 integrin subfamilies in conjunction with the anti-CD3 mAb OKT3 was inhibited. Costimulation of T cell proliferation induced by non-integrins CD4, CD26, CD28, CD44, CD45RA, or CD45RO was unaffected. Inhibition of costimulation correlated with diminished IL-2 production. In his manner, $\beta$1 integrins could regulate heterologous integrins of the $\beta$2 and $\beta$7 subfamilies in a transdominant fashion. It was also demonstrated that integrin costimulation of T cell activation was acutely sensitive to the structural conformation of $\beta$1 integrins. Using the cyclic hexapeptide CWLDVC (TBC772, which is based on the $\alpha4\beta1$ integrin binding site in fibronectin) in soluble form, it was shown that integrins locked into a conformation displaying a neo-epitope called the ligand induced binding site (LIBS) recognized by mAb 15/7 were inhibited from sending mitogenic signals to T cells. When BSA-conjugated TBC772 was coimmobilized with anti-CD3 mAb OKT3, costimulation of proliferation occurred. This suggested that temporally uncoupling integrin receptor occupancy from receptor crosslinking inhibited $\beta$1 integrin signaling mechanisms. When subsets of PB T cells were examined to determine those initially activated by integrins within 6 hours of activation, costimulation induced intracellular accumulation of IL-2 predominantly in the CD4$\sp+$ and CD45RO$\sp+$ T cell subsets. This was similar to a number of PB T cell costimulatory molecules including CD26, CD43, CD44. Only CD28 costimulated IL-2 production from both CD45RA$\sp+$ and CD45RO$\sp+$ subpopulations.^ The GTPase Rho has been implicated in regulating integrin mediated stress fiber formation and anchorage dependent growth in fibroblasts, so studies were initiated to determine if Rho played a role in integrin dependent T cell function. In order to perform this, a technique based on scrape-loading was developed to incorporate macromolecules into PB T cells that maintained their functional activity. With this technique, C3 exoenzyme from Clostridium botulinum was incorporated into PB T cells. C3 ADP-ribosylates Rho proteins on Asn$\sp{41},$ which is in close proximity to the Rho effector domain, rendering it inactive. It was demonstrated that functional Rho is not required for basal or upregulated PB T cell adhesion to $\beta$1 integrin substrates, however PB T cell homotypic aggregation induced by PMA, which is an event mediated predominantly by the integrin $\rm\alpha L\beta2,$ was delayed. PB T cells lacking Rho function displayed altered cell morphology on $\beta$1 integrin ligands, producing stellate, dendritic-like pseudopodia. Rho activity was also found to be required for integrin dependent costimulation of proliferation. When intracellular accumulation of IL-2 was measured, inactivation of Rho prevented both integrin and CD28 costimulatory activity. Rho was identified to lie upstream of signals mediating PKC activation and Ca$\sp{++}$ fluxes, as PMA and ionomycin activation of PB T cells was unaffected by the inactivation of Rho. ^

Zoning and the built environment: A public health analysis of zoning in Austin, Texas

The built environment is part of the physical environment made by people and for people. Because the built environment is such a ubiquitous component of the environment, it acts as an important pathway in determining health outcomes. Zoning, a type of urban planning policy, is one of the most important mechanisms connecting the built environment to public health. This policy analysis research paper explores how zoning regulations in Austin, Texas promote or prohibit the development of a healthy built environment. A systematic literature review was obtained from Active Living Research, which contained literature published about the relationships between the built environment, physical activity, and health. The results of these studies identified the following four components of the built environment that were associated to health: access to recreational facilities, sprawl and residential density, land use mix, and sidewalks and their walkability. A hierarchy analysis was then performed to demonstrate the association between these aspects of the built environment and health outcomes such as obesity, cardiovascular disease, and general health. Once these associations had been established, the components of the built environment were adapted into the evaluation criteria used to conduct a public health analysis of Austin's zoning ordinance. A total of eighty-eight regulations were identified to be related to these components and their varying associations to human health. Eight regulations were projected to have a negative association to health, three would have both a positive and negative association simultaneously, and nine were indeterminable with the information obtained through the literature review. The remaining sixty-eight regulations were projected to be associated in a beneficial manner to human health. Therefore, it was concluded that Austin's zoning ordinance would have an overwhelmingly positive impact on the public's health based on identified associations between the built environment and health outcomes.^

Sex, drugs, and STIs: Syphilis infection and hepatitis B vaccine compliance among illicit drug users in Houston

Although the association between syphilis infection status and compliance with the hepatitis B virus vaccine has been the focus of investigation, there is a lack of data regarding the association between syphilis infection and HBV vaccine compliance. The author investigated the association between the exposure of syphilis infection and the outcome of HBV vaccine completion, defined as degree of constancy and accuracy with which a patient follows a prescribed regimen. A cohort design was employed using interview and serological data from the Drugs, AIDS, STDs, Hepatitis (DASH) Research Project; analysis was restricted to HIV and HBV seronegative (at baseline), illicit drug users residing in Harris County. Syphilis negative and syphilis positive infection status was determined from the serological data while covariates and outcome information were determined from the DASH Project Questionnaire; enrolled subjects (n=1160) were selected from the data. Association between exposure and outcome was assessed with logistic regression adjusted for data-based confounders. ^ A prevalence of 7% and 71% was found for syphilis and HBV vaccine compliance, respectively. When measuring the actual association between syphilis infection status and HBV vaccine compliance, an odds ratio of 1.49 (95% CI: 0.86, 2.72) was obtained. There was a non-significant association between these two variables. 78% of the study population was syphilis positive and completed the vaccine series compared to 70% of the population that was syphilis negative and received all three doses. This finding confirms that there is a difference between syphilis positive and negative drug users with respect to HBV vaccine compliance. The fact that differences were found in these drug users with respect to vaccine schedule supports the idea that sub-group differences may exist and thus merits further investigation. If these differences are confirmed, it is recommended that STI interventions identify community characteristics of their samples and target populations based on practices specific to that community. ^

A screening for anti-West Nile immunoglobulin-G and immunoglobulin-M in the Cameron County Hispanic cohort

This study is designed to be a cross-sectional, retrospective analysis of the seroprevalence of anti-WNV antibodies in 1,006 plasma samples collected from February 2, 2006 to June 18, 2007 originally for The Cameron County Hispanic Cohort: Extreme obesity and uncontrolled diabetes on the U.S.-Mexico border, major concerns for populations with health disparities. The aim of this thesis research is to give a more up-to-date picture of Flavivirus activity in south Texas, which can potentially contribute to the surveillance objective of arboviral control in this area. A West Nile virus (WNV) seroprevalence study in humans in this particular area has never before been completed. Plasma samples were tested using immunoglobulin-G (IgG) and immunoglobulin-M (IgM) WNV enzyme linked immunosorbent assays (ELISA). Estimated seroprevalence for this particular population was 0.98% or 9.8 cases of West Nile disease per 1,000 citizens. After IgG testing, seroprevalence in the study population was found to be 15.4%. Specimens tested for WNV IgG were compared with a subset of specimens (N=803) tested for history of primary dengue virus (DENV) infection. Of the 803 specimens tested for IgG to DENV, 308 were positive. Of the 132 positive WNV IgG specimens in the subset, 131 (99.2%) tested also tested positive for DENV IgG. It would be helpful to use standard plaque reduction neutralization testing to determine if the seroprevalence is in fact lower because of cross-reaction to DENV on testing. Regardless of the possibility of other Flavivirus activity occurring prior to the introduction of WNV into the United States and the potential for cross-reactivity, Texas has ranked in the top 5 states with the highest, laboratory confirmed incidence of infection with WNV since 2003. Indicating that climate factors and the presence of suitable vectors makes Texas a hotspot for WNV activity. ^ A description of the study population by age, gender, and income was done indicating a statistically significant income difference with a mean household income per year being $13,413.55 for a case and $20,268.80 for non-cases (p=0.001). Lower income neighborhoods should be targeted for education and prevention of vector-borne diseases during the summer months in Cameron County. With respect to gender, being male has been noted in the literature to be a risk factor for infection with WNV (25). In this study, females comprised approximately 68% of the study population, they also made up 66.5% of the positive IgG specimens. An odds ratio of 0.91 indicates that women are less likely to be IgG positive for WNV as compared to men; however, this was not found to be significant based on the 95% confidence interval, but is consistent with the literature. When looking at age difference between positive and negative/equivocal cases, there was no statistical difference found between the two groups. ^ We concluded that this study will enable us to understand the epidemiology of WNV transmission since its introduction into the United States and hopefully to maintain or improve the current measures we have in place to prevent infections that are seen annually with WNV.^

Attitudes About Predictive MEN1 Genetic Testing in Minors

Multiple Endocrine Neoplasia type 1 (MEN1) is a hereditary cancer syndrome characterized by tumors of the endocrine system. Tumors most commonly develop in the parathyroid glands, pituitary gland, and the gastro-entero pancreatic tract. MEN1 is a highly penetrant condition and age of onset is variable. Most patients are diagnosed in early adulthood; however, rare cases of MEN1 present in early childhood. Expert consensus opinion is that predictive genetic testing should be offered at age 5 years, however there are no evidence-based studies that clearly establish that predictive genetic testing at this age would be beneficial since most symptoms do not present until later in life. This study was designed to explore attitudes about the most appropriate age for predictive genetic testing from individuals at risk of having a child with MEN1. Participants who had an MEN1 mutation were invited to complete a survey and were asked to invite their spouses to participate as well. The survey included several validated measures designed to assess participants’ attitudes about predictive testing in minors. Fifty-eight affected participants and twenty-two spouses/partners completed the survey. Most participants felt that MEN1 genetic testing was appropriate in healthy minors. Younger age and increased knowledge of MEN1 genetics and inheritance predicted genetic testing at a younger age. Additionally, participants who saw more positive than negative general outcomes from genetic testing were more likely to favor genetic testing at younger ages. Overall, participants felt genetic testing should be offered at a younger age than most adult onset conditions and most felt the appropriate time for testing was when a child could understand and participate in the testing process. Psychological concerns seemed to be the primary focus of participants who favored later ages for genetic testing, while medical benefits were more commonly cited for younger age. This exploratory study has implications for counseling patients whose children are at risk of developing MEN1 and illustrates issues that are important to patients and their spouses when considering testing in children.

DETERMINING THE GENOTYPE-PHENOTYPE CONNECTION IN SYNTHETIC INDUCIBLE GENE EXPRESSION SYSTEMS

Introduction Gene expression is an important process whereby the genotype controls an individual cell’s phenotype. However, even genetically identical cells display a variety of phenotypes, which may be attributed to differences in their environment. Yet, even after controlling for these two factors, individual phenotypes still diverge due to noisy gene expression. Synthetic gene expression systems allow investigators to isolate, control, and measure the effects of noise on cell phenotypes. I used mathematical and computational methods to design, study, and predict the behavior of synthetic gene expression systems in S. cerevisiae, which were affected by noise. Methods I created probabilistic biochemical reaction models from known behaviors of the tetR and rtTA genes, gene products, and their gene architectures. I then simplified these models to account for essential behaviors of gene expression systems. Finally, I used these models to predict behaviors of modified gene expression systems, which were experimentally verified. Results Cell growth, which is often ignored when formulating chemical kinetics models, was essential for understanding gene expression behavior. Models incorporating growth effects were used to explain unexpected reductions in gene expression noise, design a set of gene expression systems with “linear” dose-responses, and quantify the speed with which cells explored their fitness landscapes due to noisy gene expression. Conclusions Models incorporating noisy gene expression and cell division were necessary to design, understand, and predict the behaviors of synthetic gene expression systems. The methods and models developed here will allow investigators to more efficiently design new gene expression systems, and infer gene expression properties of TetR based systems.

Indeterminate QunatiFERON-TB Gold In-Tube assay results in association with procedural specimen collection in children

BACKGROUND. The development of interferon-gamma release assays (IGRA) has introduced powerful tools in diagnosing latent tuberculosis infection (LTBI) and may play a critical role in the future of tuberculosis diagnosis. However, there have been reports of high indeterminate results in young patient populations (0-18 years). This study investigated results of the QunatiFERON-TB Gold In-Tube (QFT-GIT) IGRA in a population of children (0-18 years) at Texas Children's Hospital in association with specimen collection procedures using surrogate variables. ^ METHODS. A retrospective case-control study design was used for this investigation. Cases were defined as having QFT-GIT indeterminate results. Controls were defined as having either positive or negative results (determinates). Patients' admission status, staff performing specimen collection, and specific nurse performing specimen collection were used as surrogates to measure specimen collection procedures. ^ To minimize potential confounding, abstraction of patients' electronic medical records was performed. Abstracted data included patients' medications and evaluation at the time of QFT-GIT specimen collection in addition to their medical history. QFT-GIT related data was also abstracted. Cases and controls were characterized using chi-squared tests or Fisher's exact tests across categorical variables. Continuous variables were analyzed using one-way ANOVA and t-tests for continuous variables. A multivariate model was constructed by backward stepwise removal of statistically significant variables from univariate analysis. ^ RESULTS. Patient data was abstracted from 182 individuals aged 0-18 years from July 2010 to August 2011 at Texas Children's Hospital. 56 cases (indeterminates) and 126 controls (determinates) were enrolled. Cancer was found to be an effect modifier with subsequent stratification resulting in a cancer patient population too small to analyze (n=13). Subsequent analyses excluded these patients. ^ The exclusion of cancer patients resulted in a population of 169 patients with 49 indeterminates (28.99%) and 120 determinates (71.01%), with mean ages of 9.73 (95% CI: 8.03, 11.43) years and 11.66 (95% CI: 10.75, 12.56) years (p = 0.033), respectively. Median age of patients who were indeterminates and determinates were 12.37 and 12.87 years, respectively. Lack of data for our specific nurse surrogate (QFTNurse) resulted in its exclusion from analysis. The final model included only our remaining surrogate variables (QFTStaff and QFTInpatientOutpatient). The staff collecting surrogate (QFTStaff) was found to be modestly associated with indeterminates when nurses collected the specimen (OR = 1.54, 95% CI: 0.51, 4.64, p = 0.439) in the final model. Inpatients were found to have a strong and statistically significant association with indeterminates (OR = 11.65, 95% CI: 3.89, 34.9, p < 0.001) in the final model. ^ CONCLUSION. Inpatient status was used as a surrogate for indication of nurse drawn blood specimens. Nurses have had little to no training regarding shaking of tubes versus phlebotomists regarding QFT-GIT testing procedures. This was also measured by two other surrogates; specifically a medical note stating whether a nurse or phlebotomist collected the specimen (QFTStaff) and the name and title of the specific nurse if collection was performed by a nurse (QFTNurse). Results indicated that inpatient status was a strong and statistically significant factor for indeterminates, however, nurse collected specimens and indeterminate results had no statistically significant association in non-cancer patients. The lack of data denoting the specific nurse performing specimen collection excluded the QFTNurse surrogate in our analysis. ^ Findings suggests training of staff personnel in specimen procedures may have little effect on the number of indeterminates while inpatient status and thus possibly illness severity may be the most important factor for indeterminate results in this population. The lack of congruence between our surrogate measures may imply that our inpatient surrogate gauged illness severity rather than collection procedures as intended. ^ Despite the lack of clear findings, our analysis indicated that more than half of indeterminates were found in specimens drawn by nurses and as such staff training may be explored. Future studies may explore methods in measuring modifiable variables during pre-analytical QFT-GIT procedures that can be discerned and controlled. Identification of such measures may provide insight into ways to lowering indeterminate QFT-GIT rates in children.^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Subjective well -being as predictor of mortality, heart disease, and obesity: Prospective evidence from the Alameda County Study

Based on the World Health Organization's (1965) definition of health, understanding of health requires understanding of positive psychological states. Subjective Well-being (SWB) is a major indicator of positive psychological states. Up to date, most studies of SWB have been focused on its distributions and determinants. However, study of its consequences, especially health consequences, is lacking. This dissertation research examined Subjective Well-being, as operationally defined by constructs drawn from the framework of Positive Psychology, and its sub-scores (Positive Feelings and Negative Feelings) as predictors of three major health outcomes—mortality, heart disease, and obesity. The research used prospective data from the Alameda County Study over 29 years (1965–1994), based on a stratified, randomized, representative sample of the general public in Alameda County, California (Baseline N = 6928). ^ Multivariate analyses (Survival analyses using sequential Cox Proportional Hazard models in the cases of mortality and heart disease, and sequential Logistic Regression analyses in the case of obesity) were performed as the main methods to evaluate the associations of the predictors and the health outcomes. The results revealed that SWB reduced risks of all-cause mortality, natural-cause mortality, and cardiovascular mortality. Positive feelings not only had an even stronger protective effect against all-cause, natural-cause and cardiovascular mortality, but also predicted decreased unnatural-cause mortality which includes deaths from suicide, homicide, accidents, mental disorders, drug dependency, as well as alcohol-related liver diseases. These effects were significant even after adjusted for age, gender, education, and various physical health measures, and, in the case of cardiovascular mortality, obesity and health practices (alcohol consumption, smoking, and physical activities). However, these two positive psychological indicators, SWB and positive feelings, did not predict obesity. And negative feelings had no significant effect on any of the health outcomes evaluated, i.e., all-cause mortality, natural- and unnatural-cause mortality, cardiovascular mortality, or obesity, after covariates were controlled. These findings were discussed (1) in comparison with relevant existing studies, (2) in terms of their implications in health research and promotion, (3) in terms of the independence of positive and negative feelings, and (4) from a Positive Psychology perspective and its significance in Public Health research and practice. ^