Insight into the strand exchange reaction promoted by the RecA protein of {\it Escherichia coli\/}

In vitro, RecA protein catalyses the exchange of single strands of DNA between different DNA molecules with sequence complementarity. In order to gain insight into this complex reaction and the roles of ATP binding and hydrolysis, two different approaches have been taken. The first is to use short single-stranded deoxyoligonucleotides as the ssDNA in strand exchange. These were used to determine the signal for hydrolysis and the structure of the RecA-DNA complex that hydrolyses ATP. I present a defined kinetic analysis of the nucleotide triphosphatase activity of RecA protein using short oligonucleotides as ssDNA cofactor. I compare the effects of both homopolymers and mixed base composition oligomers on the ATPase activity of RecA protein. I examine the steady state kinetic parameters of the ATPase reaction using these oligonucleotides as ssDNA cofactor, and show that although RecA can both bind to, and utilise, oligonucleotides 7 to 20 residues in length to support the repressor cleavage activity of RecA, these oligonucleotides are unable to efficiently stimulate the ATPase activity of RecA protein. I show that the K$\sb{\rm m}\sp{\rm ATP}$, the Hill coefficient for ATP binding, the extent of reaction, and k$\sb{\rm cat}$ are all a function of ssDNA chain length and that secondary structure may also play a role in determining the effects of a particular chain length on the ATPase activity of RecA protein.^ The second approach is to utilise one of the many mutants of RecA to gain insight into this complex reaction. The mutant selected was RecA1332. Surprisingly, in vitro, this mutant possesses a DNA-dependent ATPase activity. The K$\sb{\rm m}\sp{\rm ATP}$, Hill coefficient for ATP binding, and K$\sb{\rm m}\sp{\rm DNA}$ are similar to that of wild type. k$\sb{\rm cat}$ for the ATPase activity is reduced 3 to 12-fold, however. RecA1332 is unable to use deoxyoligonucleotides as DNA cofactors in the ATPase reaction, and demonstrates an increased sensitivity to inhibition by monovalent ions. It is able to perform strand exchange with ATP and ATP$\lbrack\gamma\rbrack$S but not with UTP, whereas the wild type protein is able to use all three nucleotide triphosphates. RecA1332 appears to be slowed in its ability to form intermediates and to convert these intermediates to products. (Abstract shortened by UMI.) ^

Transcriptional regulation and functional analysis of the human Wilms' tumor 1 gene

The Wilms' tumor 1 gene (WT1) encodes a zinc-finger transcription factor and is expressed in urogenital, hematopoietic and other tissues. It is expressed in a temporal and spatial manner in both embryonic and adult stages. To obtain a better understanding of the biological function of WT1, we studied two aspects of WT1 regulation: one is the identification of tissue-specific cis-regulatory elements that regulate its expression, the other is the downstream genes which are modulated by WT1.^ My studies indicate that in addition to the promoter, other regulatory elements are required for the tissue specific expression of this gene. A 259-bp hematopoietic specific enhancer in intron 3 of the WT1 gene increased the transcriptional activity of the WT1 promoter by 8- to 10-fold in K562 and HL60 cells. Sequence analysis revealed both GATA and c-Myb motifs in the enhancer fragment. Mutation of the GATA motif decreased the enhancer activity by 60% in K562 cells. Electrophoretic mobility shift assays showed that both GATA-1 and GATA-2 proteins in K562 nuclear extracts bind to this motif. Cotransfection of the enhancer containing reporter construct with a GATA-1 or GATA-2 expression vector showed that both GATA-1 and GATA-2 transactivated this enhancer, increasing the CAT reporter activity 10-15 fold and 5-fold respectively. Similar analysis of the c-Myb motif by cotransfection with the enhancer CAT reporter construct and a c-Myb expression vector showed that c-Myb transactivated the enhancer by 5-fold. A DNase I-hypersensitive site has been identified in the 258 bp enhancer region. These data suggest that GATA-1 and c-Myb are responsible for the activity of this enhancer in hematopoietic cells and may bind to the enhancer in vivo. In the process of searching for cis-regulatory elements in transgenic mice, we have identified a 1.0 kb fragment that is 50 kb downstream from the promoter and is required for the central nervous system expression of WT1.^ In the search for downstream target genes of WT1, we noted that the proto-oncogene N-myc is coexpressed with the tumor suppressor gene WT1 in the developing kidney and is overexpressed in many Wilms' tumors. Sequence analysis revealed eleven consensus WT1 binding sites located in the 1 kb mouse N-myc promoter. We further showed that the N-myc promoter was down-regulated by WT1 in transient transfection assays. Electrophoretic mobility shift assays showed that oligonucleotides containing the WT1 motifs could bind WT1 protein. Furthermore, a Denys-Drash syndrome mutant of WT1, R394W, that has a mutation in the DNA binding domain, failed to repress the N-myc promoter. This suggests that the repression of the N-myc promoter is mediated by DNA binding of WT1. This finding helps to elucidate the relationship of WT1 and N-myc in tumorigenesis and renal development. ^

Peptide nucleic acids: Mechanism of tight binding and application in artificial nuclease

Peptide nucleic acids (PNA) are mimics of nucleic acids with a peptidic backbone. Duplexes and triplexes formed between PNA and DNA or RNA possess remarkable thermal stability, they are resistant to nuclease cleavage and can better discriminate mismatches. Understanding the mechanism for the tight binding between PNA and oligonucleotides is important for the design and development of better PNA-based drugs.^ We have performed molecular dynamics (MD) simulations of 8-mer PNA/DNA duplex and two analogous duplexes with chiral modification of PNA strand (D- or L-Alanine modification). MD simulations were performed with explicit water and Na$\sp{+}$ counter ions. The 1.5-ns simulations were carried out with AMBER using periodic boundary and particle mesh Ewald summation. The point charges for PNA monomers were derived from fitting electrostatic potentials, obtained from ab initio calculation, to atomic centers using RESP. Derived charges reveal significantly altered charge distribution on the PNA bases and predict the Watson-Crick H-bonds involving PNA to be stronger. Results from NMR studies investigating H-bond interactions between DNA-DNA and DNA-PNA base pairs in non-polar environment are consistent with this prediction. MD simulations demonstrated that the PNA strand is more flexible than the DNA strand in the same duplex. That this flexibility might be important for the duplex stability is tested by introducing modification into the PNA backbones. Results from MD simulation revealed dramatically altered structures for the modified PNA-DNA duplexes. Consistent with previous NMR results, we also found no intrachain hydrogen bonds between O7$\sp\prime$ and N1$\sp\prime$ of the neighboring residues in our MD study. Our study reveals that in addition to the lack of charge repulsion, stronger Watson-Crick hydrogen bonds together with flexible backbone are important factors for the enhanced stability of the PNA-DNA duplex.^ In a related study, we have developed an application of Gly-Gly-His-(Gly)$\sb3$-PNA conjugate as an artificial nuclease. We were able to demonstrate cleavage of single stranded DNA at a single site upon Ni(II) binding to Gly-Gly-His tripeptide and activation of nuclease with monoperoxyphthalic acid. ^

TH and XFKBP12 interact and regulate proliferation and differentiation in neural ectoderm through the TOR signaling pathway

During development, embryos must carefully integrate the processes of cell proliferation and differentiation. TH has been identified in Xenopus laevis as a gene product that functions in regulating differentiation of the neural ectoderm through its effect on cell proliferation. However, the mechanism and molecular pathway through which TH functions are not known. We identified the Xenopus FK506 binding protein homolog (XFKBP12) as a protein that interacted with TH in a yeast two-hybrid screen with TH as the bait. The direct and specific interaction between TH and XFKBP12 was supported by several tests including CO-IP, drug competence assay and mutagenesis analysis. To investigate the function of XFKBP12 during embryogenesis, we created an XFKBP12 loss of function embryo using antisense morpholino oligonucleotides (MO). XFKBP12 MO injected embryos displayed similar phenotypes as TH depleted embryos. We also demonstrated that both TH and XFKBP12 functioned through the TOR signaling pathway which is a target for cancer therapies. The interaction between TH and XFKBP 12 was required to regulate the proliferation of neural cells. Therefore, our study indicates that TH represents the endogenous ligand of XFKBP12 and together they coordinate neural cell proliferation and differentiation through the conserved rapamycin sensitive TOR pathway. Thus, understanding how this pathway functions in development will not only provide us important insights into the relationship between proliferation and differentiation, but help design rational cancer therapies targeting this pathway. ^

Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Tackling ErbB2: ErbB2-targeting peptide therapy and combination therapy with trastuzumab plus PI3K inhibitors

ErbB2 is an excellent target for cancer therapies because its overexpression was found in about 30% of breast cancers and correlated with poor prognosis of the patients. Unfortunately, current therapies for ErbB2-positive breast cancers remain unsatisfying due to side effects and resistance, and new therapies for ErbB2 overexpressing breast cancers are needed. Peptide/protein therapy using cell-penetrating peptides (CPPs) as carriers is promising because the internalization is highly efficient and the cargos can be bioactive. The major obstacle in using CPPs for therapy is their lack of specificity. We sought to develop a peptide carrier specifically introducing therapeutics to ErbB2-overexpressing breast cancer cells. By modifying the TAT-derived CPP, and attaching anti-HER2/neu peptide mimetic (AHNP), we developed the peptide carrier (P3-AHNP) specifically targeted ErbB2-overexpressing breast cancers in vitro and in vivo. A STAT3 SH2 domain-binding peptide conjugated to this peptide carrier (P3-AHNP-STAT3BP) was delivered preferentially into ErbB2-overexpressing breast cancer cells in vitro and in vivo. P3-AHNP-STAT3BP inhibited growth and induced apoptosis in vitro, with ErbB2-overexpressing 435.eB cells being more sensitive than the ErbB2-lowexpressing MDA-MB-435 cells. P3-AHNP-STAT3BP preferentially accumulated and inhibited growth in 435.eB xenografts, comparing with MDA-MB-435 xenografts or normal tissues with low levels of ErbB2. This ErbB2-targeting peptide delivery system provided the basis for future development of novel cancer target-specific treatments with low toxicity to normal cells. ^ Another urgent issue in treating ErbB2-positive breast cancers is trastuzumab resistance. Trastuzumab is the only FDA-approved ErbB2-targeting antibody for treatment of metastatic breast cancers overexpressing ErbB2, and has remarkable therapeutic efficacy in certain patients. The overall trastuzumab response rate, however, is limited, and understanding the mechanisms of trastuzumab resistance is needed to overcome this problem. We report that PTEN activation contributes to trastuzumab's anti-tumor activity. Trastuzumab treatment quickly inactivated Src, which reduced PTEN tyrosine phosphorylation, increased PTEN membrane localization and its phosphatase activity in cancer cells. Reducing PTEN expression in breast cancer cells by antisense oligonucleotides conferred trastuzumab resistance in vitro and in vivo. Importantly, PI3K inhibitors sensitized PTEN-deficient breast cancers to the growth inhibition by trastuzumab in vitro and in vivo, suggesting that combination therapies with PI3K inhibitors plus trastuzumab could overcome trastuzumab resistance. ^

Roles of mismatch repair proteins in the recognition and processing of DNA interstrand crosslinks in human cells

DNA interstrand crosslinks (ICLs) are among the most toxic type of damage to a cell. Many ICL-inducing agents are widely used as therapeutic agents, e.g. cisplatin, psoralen. A bettor understanding of the cellular mechanism that eliminates ICLs is important for the improvement of human health. However, ICL repair is still poorly understood in mammals. Using a triplex-directed site-specific ICL model, we studied the roles of mismatch repair (MMR) proteins in ICL repair in human cells. We are also interested in using psoralen-conjugated triplex-forming oligonucleotides (TFOs) to direct ICLs to a specific site in targeted DNA and in the mammalian genomes. ^ MSH2 protein is the common subunit of two MMR recognition complexes, and MutSα and MutSβ. We showed that MSH2 deficiency renders human cell hypersensitive to psoralen ICLs. MMR recognition complexes bind specifically to triplex-directed psoralen ICLs in vitro. Together with the fact that psoralen ICL-induced repair synthesis is dramatically decreased in MSH2 deficient cell extracts, we demonstrated that MSH2 function is critical for the recognition and processing of psoralen ICLs in human cells. Interestingly, lack of MSH2 does not reduce the level of psoralen ICL-induced mutagenesis in human cells, suggesting that MSH2 does not contribute to error-generating repair of psoralen ICLs, and therefore, may represent a novel error-free mechanism for repairing ICLs. We also studied the role of MLH1, anther key protein in MMR, in the processing of psoralen ICLs. MLH1-deficient human cells are more resistant to psoralen plus UVA treatment. Importantly, MLH1 function is not required for the mutagenic repair of psoralen ICLs, suggesting that it is not involved in the error-generating repair of this type of DNA damage in human cells. ^ These are the first data indicating mismatch repair proteins may participate in a relatively error-free mechanism for processing psoralen ICL in human cells. Enhancement of MMR protein function relative to nucleotide excision repair proteins may reduce the mutagenesis caused by DNA ICLs in humans. ^ In order to specifically target ICLs to mammalian genes, we identified novel TFO target sequences in mouse and human genomes. Using this information, many critical mammalian genes can now be targeted by TFOs.^

The role of plasmacytoid dendritic cells in the regulation of adaptive immunity

Plasmacytoid dendritic cells (pDCs) selectively express TLR7 which allows them to respond to RNA viruses and TLR9 which allows them to respond to DNA viruses and CpG oligonucleotides. Upon exposure to virus pDCs produce vast amounts of type I interferon (IFN) directly inhibiting viral replication and contributing to the activation of other immune cells. The ability of pDCs to promote B and T cell differentiation through type I IFN has been well documented although the role of additional factors including tumor necrosis factor (TNF) family members has not been thoroughly addressed. Here the expression of selected TNF family members in pDCs was examined and the role of TNF receptor-ligand interactions in the regulation of B and T lymphocyte growth and differentiation by pDCs was investigated. Upon stimulation with CpG-B, pDCs exhibit strong and stable expression of CD70, a TNF family ligand that binds to its receptor CD27 on memory B cells and promotes plasma cell differentiation and Ig secretion. Using an in vitro pDC/B cell co-culture system, it was determined that CpG-B-stimulated pDCs induce the proliferation of CD40L-activated human peripheral B cells and Ig secretion. This occurs independently of IFN and residual CpG, and requires physical contact between pDCs and B cells. CpG-stimulated pDCs induce the proliferation of both naive and memory B cells although Ig secretion is restricted to the memory subset. Blocking the interaction of CD70 with CD27 using an antagonist anti-CD70 antibody reduces the induction of B cell proliferation and IgG secretion by CpG-B-stimulated pDCs. Published studies have also indicated an important role for CD70 in promoting the expansion of CD4+ and CD8+ T cells and the development of effector function. CpG-B-stimulated pDCs induce naïve CD4+ T cell proliferation and production of multiple cytokines including IFN-γ, TNF-α, IL-10, IL-4, IL-5 and IL-13. Blocking the function of CD70 with an antagonist anti-CD70 antibody significantly reduced the induction of naïve CD4+ T cell proliferation by CpG-B-stimulated pDCs and the production of IL-4 and IL-13. Collectively these data indicate an important role for CD70 in the regulation of B and T lymphocyte growth and differentiation by pDCs. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

G -rich oligodeoxyribonucleotides: Triplexes and transcription

Formation of a triple helix resulting from oligonucleotide binding to the DNA double helix offers new possibilities to control gene expression at the transcriptional level. Purine-motif triplexes can be formed under physiological pH. Nevertheless, this formation was inhibited by certain monovalent cations during the association but not during dissociation. Since triplexes are very stable, it was possible to assemble them in the absence of KCl and have them survive throughout the course of an in vitro transcription reaction. As for the design of a better triplex-forming oligonucleotide, 12 nucleotides in length afforded the highest binding affinity. G/T-rich oligonucleotides can be very polymorphic in solution. The conditions for forming purine-motif triplexes, duplexes or G-quartets were determined. Understanding these parameters will be important for the practical use of G-rich oligonucleotides in the development of DNA aptamers where the structure of the oligonucleotide is paramount in dictating its function. Finally, purine-motif triplexes were demonstrated to significantly inhibit gene transcription in vitro. The optimal effect on this process was dependent on the location of triplexes within the promoter, i.e., whether upstream or proximally downstream of the transcription start site. The mechanism for the inhibition of transcription appeared to be interference with initiation through preventing engagement by RNA polymerase. This finding is revolutionary when compared to the conventional model where triplexes inhibit transcription only by occluding binding by trans-acting proteins. Our findings broaden the utility of triplexes and support a strategy for antigene therapy by triplexes. ^

Role of janus tyrosine kinase -3 (JAK3) and signal transducer and activator of transcription (STAT5) pathway in T lymphocyte activation

T cell activation and expansion is essential for immune response against foreign antigens. However, uncontrolled T cell activity can be manifested as a number of lymphoid derived diseases such as autoimmunity, graft versus host disease, and lymphoma. The purpose of this research was to test the central hypothesis that the Jak3/Stat5 pathway is critical for T cell function. To accomplish this objective, two novel Jak3 inhibitors, AG490 and PNU156804, were identified and their effects characterized on Jak3/Stat5 activation and T cell growth. Inhibition of Jak3 selectively disrupted primary human T lymphocyte growth in response to Interleukin-2 (IL-2), as well as other γ c cytokine family members including IL-4, IL-7, IL-9, and IL-15. Inhibition of Jak3 ablated IL-2 induced Stat5 but not TNF-α mediated NF-κβ DNA binding. Loss of Jak3 activity did not affect T cell receptor mediated signals including activation of p56Lck and Zap70, or IL-2 receptor a chain expression. To examine the effects of Jak3/Stat5 inhibition within a mature immune system, we employed a rat heart allograft model of Lewis (RT1 1) to ACI (RT1a). Heart allograft survival was significantly prolonged following Jak3/Stat5 inhibition when rats were treated with AG490 (20mg/kg) or PNU156804 (80mg/kg) compared to non-treated control animals. This effect was synergistically potentiated when Jak3 inhibitors were used in combination with a signal 1/2 disrupter, cyclosporine, but only additively potentiated with another signal 3 inhibitor, rapamycin. This suggested that sequential inhibition of T cell function is more effective. To specifically address the role of Stat5 in maintaining T cell activity, novel Stat5 antisense oligonucleotides were synthesized and characterized in vitro. Primary human T cells and T-cell tumor lines treated with Stat5 antisense oligonucleotide (7.5 μM) rapidly underwent apoptosis, while no changes in cell cycle were observed as measured by FACS analysis utilizing Annexin-V-Fluorescein and Propidium iodide staining. Evidence is provided to suggest that caspase 8 and 9 pathways mediate this event. Thus, Stat5 may act rather as a negative regulator of apoptotic signals and not as a positive regulator of cell cycle as previously proposed. We conclude that the Jak3/Stat5 pathway is critical for γc cytokine mediated gene expression necessary for T cell expansion and normal immune function and represents an therapeutically relevant effector pathway to combat T cell derived disease. ^

Developmental functions of XKaiso, a transcriptional repressor associating with the p120 catenin in Xenopus laevis

The Armadillo family catenin proteins function in multiple capacities including cadherin-mediated cell-cell adhesion and nuclear signaling. The newest catenin, p120 catenin, differs from the classical catenins and binds to the membrane-proximal domain of cadherins. Recently, a novel transcription factor Kaiso was found to interact with p120 catenin, suggesting that p120 catenin also possesses a nuclear function. We isolated the Xenopus homolog of Kaiso, XKaiso, from a Xenopus stage 17 cDNA library. XKaiso contains an amino-terminal BTB/POZ domain and three carboxyl-terminal zinc fingers. The XKaiso transcript was present maternally and expressed throughout early embryonic development. XKaiso's spatial expression was defined via in situ hybridization and was found localized to the brain, eye, ear, branchial arches, and spinal cord. Co-immunoprecipitation of Xenopus p120 catenin and XKaiso demonstrated their mutual association, while related experiments employing differentially epitope-tagged XKaiso constructs suggest that XKaiso also self-associates. On the functional level, reporter assays employing a chimera of XKaiso fused to the GAL4 DNA binding domain indicated that XKaiso is a transcriptional repressor. To better understand the significance of the Kaiso-p120 catenin complex in vertebrate development, Kaiso knock-down experiments were undertaken, and the modulatory role of p120 catenin in Kaiso function examined during Xenopus development. Using morpholino antisense oligonucleotides to block translation of XKaiso, XKaiso was found to be essential for Xenopus gastrulation, being required for correct morphogenetic movements in early embryogenesis. Molecular marker analyses indicated that one target gene of the Wnt/β-catenin pathway, Siamois, is significantly increased in embryos depleted for XKaiso, while other dorsal, ventral, and mesodermal cell fate markers were unaltered. In addition, the non-canonical Wnt-11, known to participate in planar cell polarity/convergent extension processes, was significantly upregulated following depletion of XKaiso. Such increased Wnt-11 expression likely contributed to the XKaiso depletion phenotype because a dominant negative form of Wnt-11 or of the downstream effector Dishevelled partially rescued the observed gastrulation defects. These results show that XKaiso is essential for proper gastrulation movements, resulting at least in part from its modulation of non-canonical Wnt signaling. The significance of the XKaiso-p120 catenin interaction has yet to be determined, but appears to include a role in modulating genes promoting canonical and non-canonical Wnt signals. ^