Rules to limit snacking in front of the TV and childhood BMI status: Findings from the "Fun Families Study"

Childhood obesity is increasing at epidemic rates, and thus there is a need to target appropriate childhood behaviors that contribute to obesity. Many factors contribute to childhood weight status. The aim of this study was to look at relationships between parental rules to limit snacking while watching television and childhood weight status. The study looked at the presence of the behavior of snacking while watching television yesterday, congruence between child- and parent-reported perception of the presence of rules to limit snacking while watching television, and parent-reported frequency of children following rules to limit snacking while watching television. The outcomes were examined in a multi-ethnic population of children ages 6 to 9 years in Southeast Texas.^ This study was a cross-sectional secondary data analysis of the pilot program, Fun Families. This study examined baseline data from 202 parent-child dyads, which included both the control ( N= 101) and intervention groups (N= 101). Data were gathered using validated questions that were administered to 6-9 year old children and their primary caregiver (referred to as parent in the rest of the discussion) in Southeast Texas, between 2006 and 2008. The main study outcome was childhood weight status based on CDC BMI-for-age categories. The independent variables are (1) the presence of parental rules to limit snacking while watching television, (2) the congruence between child and parent about the presence of rules to limit snacking while watching television, and (3) the parent-reported frequency of the child following the rules to limit snacking while watching television. Chi-Square analyses were used to determine if weight status was different for (1) children who reported rules to limit snacking yesterday, (2) children who reported snacking, (3) children whose parents reported rules were present, and (4) those who had rule congruence with the parents not. Chi-Square analyses also examined if there was a difference in the presence of snacking behavior for children who reported rules, for children whose parents reported rules, and for those children who had congruence about rules. Linear regressions were used to determine if any of the studied variables predicted increased weight status or reported snacking while watching television yesterday.^ This study found that child-reported snacking yesterday was significantly different for children who reported rules (4.12, p= 0.04). Child-reported rules was significantly associated with (p= -0.14, α= 0.04) and predicted child-reported snacking yesterday (R 2 0.021, p= 0.04, t= -2.04, 95% CI -0.31, -0.01). There was statistical significant incongruence between child and parent perception about the presence of rules to limit snacking yesterday (15.06, p= 0.00). For this population, parent education level was significantly associated with child-reported rules (r= -0.16, p= 0.02), child-reported snacking yesterday (r= -0.15, p= 0.04), and parent-reported frequency of child following rules to limit snacking (r= 0.29, p= -0.01). Parent-reported speaking another language besides English at home was significantly associated with parent-reported rules (r= 0.17, p= 0.02).^ Although the studied variables did not show any significant associations or predictors for childhood weight status, the significant discord between parent and child perception about the presence of rules provides valuable information to future interventions that aim to reduce childhood weight status. Including the creation and enforcement of parental rules in interventions to reduce childhood weight status will be beneficial for future studies.^

Gene therapy of cancer: Mechanisms of ``bystander effect'' killing in cells expressing the herpes simplex virus-thymidine kinase gene and its potential clinical applications

At the fore-front of cancer research, gene therapy offers the potential to either promote cell death or alter the behavior of tumor-cells. One example makes use of a toxic phenotype generated by the prodrug metabolizing gene, thymidine kinase (HSVtk) from the Herpes Simplex Virus. This gene confers selective toxicity to a relatively nontoxic prodrug, ganciclovir (GCV). Tumor cells transduced with the HSVtk gene are sensitive to 1-50 $\mu$M GCV; normal tissue is insensitive up to 150-250 $\mu$M GCV. Utilizing these different sensitivities, it is possible to selectively ablate tumor cells expressing this gene. Interestingly, if a HSVtk$\sp+$ expressing population is mixed with a HSVtk$\sp-$ population at high density, all the cells are killed after GCV administration. This phenomenon for killing all neighboring cells is termed the "bystander effect", which is well documented in HSVtk$\sp-$ GCV systems, though its exact mechanism of action is unclear.^ Using the mouse colon carcinoma cell line CT26, data are presented supporting possible mechanisms of "bystander effect" killing of neighboring CT26-tk$\sp-$cells. A major requirement for bystander killing is the prodrug GCV: as dead or dying CT26tk$\sp+$ cells have no toxic effect on neighboring cells in its absence. In vitro, it appears the bystander effect is due to transfer of toxic GCV-metabolites, through verapamil sensitive intracellular-junctions. Additionally, possible transfer of the HSVtk enzyme to bystander cells after GCV addition, may play a role in bystander killing. A nude mouse model suggests that in a 50/50 (tk$\sp+$/tk$\sp-$) mixture of CT26 cells the bystander eradication of tumors does not involve an immune component. Additionally in a possible clinical application, the "bystander effect" can be directly exploited to eradicate preexisting CT26 colon carcinomas in mice by intratumoral implantation of viable or lethally irradiated CT26tk$\sp+$ cells and subsequent GCV administration. Lastly, an application of this toxic phenotype gene to a clinical marking protocol utilizing a recombinant adenoviral vector carrying the bifunctional protein GAL-TEK to eradicate spontaneously-arisen or vaccine-induced fibrosarcomas in cats is demonstrated. ^

Transcriptional regulation of the {\it neu\/} oncogene and its negative regulation by the c-{\it myc\/} oncogene

The first part of my research involved the characterization of the neu gene promoter. I subcloned a 2.2-kb sequence located upstream to the extreme 5$\sp\prime$ end of the neu gene, in front of the bacterial reporter gene, chloramphenicol acetyltransferase (CAT). Transfection of this construct into different cell lines and subsequent CAT assays demonstrated that this 2.2-kb fragment was functional as a promoter. A series of deletion constructs was engineered to study the contribution of different fragments to transcription. Subcloning of individual fragments was followed by a cotransfection competition experiment, which demonstrated the involvement of protein factors interacting with the promoter. A gel retardation assay was also performed to show the physical binding of protein factors to the promoter. The combined results suggested that both positively and negatively acting protein factors are involved in interacting with different regions of the promoter, contributing to the overall transcription activity. My findings provide an insight into the regulation of neu gene expression, which in turn provides the tools to understand the molecular mechanisms of overexpression of the neu gene in some breast cancer and ovarian cancer cell lines.^ In the second part of my research, I discovered that another oncogene, c-myc, was able to reverse the transformed morphology that was induced by the neu oncogene. Utilizing the promoter constructs that I made, I was able to show that the c-myc oncogene has a negative regulatory effect on the expression of the neu oncogene. Further studies suggested that c-myc is able to lower the effective concentration of a positive factor(s) that interact with a 139-bp fragment of the neu gene promoter. These findings may provide a direct evidence of the long suspected role of the c-myc gene in transcriptional regulation. The neu gene may very well be the first identified mammalian target gene that is regulated by the c-myc oncogene. Since c-myc is known to be stimulated by various mitogenic signals and the neu gene is likely to be a growth factor receptor, it is possible that c-myc, when stimulated by the signal transduction pathway of the neu gene, would function as a negative feedback regulator on the neu gene receptor. (Abstract shortened with permission of author.) ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^