13 resultados para Thymidine Kinase -- genetics
em DigitalCommons@The Texas Medical Center
Resumo:
At the fore-front of cancer research, gene therapy offers the potential to either promote cell death or alter the behavior of tumor-cells. One example makes use of a toxic phenotype generated by the prodrug metabolizing gene, thymidine kinase (HSVtk) from the Herpes Simplex Virus. This gene confers selective toxicity to a relatively nontoxic prodrug, ganciclovir (GCV). Tumor cells transduced with the HSVtk gene are sensitive to 1-50 $\mu$M GCV; normal tissue is insensitive up to 150-250 $\mu$M GCV. Utilizing these different sensitivities, it is possible to selectively ablate tumor cells expressing this gene. Interestingly, if a HSVtk$\sp+$ expressing population is mixed with a HSVtk$\sp-$ population at high density, all the cells are killed after GCV administration. This phenomenon for killing all neighboring cells is termed the "bystander effect", which is well documented in HSVtk$\sp-$ GCV systems, though its exact mechanism of action is unclear.^ Using the mouse colon carcinoma cell line CT26, data are presented supporting possible mechanisms of "bystander effect" killing of neighboring CT26-tk$\sp-$cells. A major requirement for bystander killing is the prodrug GCV: as dead or dying CT26tk$\sp+$ cells have no toxic effect on neighboring cells in its absence. In vitro, it appears the bystander effect is due to transfer of toxic GCV-metabolites, through verapamil sensitive intracellular-junctions. Additionally, possible transfer of the HSVtk enzyme to bystander cells after GCV addition, may play a role in bystander killing. A nude mouse model suggests that in a 50/50 (tk$\sp+$/tk$\sp-$) mixture of CT26 cells the bystander eradication of tumors does not involve an immune component. Additionally in a possible clinical application, the "bystander effect" can be directly exploited to eradicate preexisting CT26 colon carcinomas in mice by intratumoral implantation of viable or lethally irradiated CT26tk$\sp+$ cells and subsequent GCV administration. Lastly, an application of this toxic phenotype gene to a clinical marking protocol utilizing a recombinant adenoviral vector carrying the bifunctional protein GAL-TEK to eradicate spontaneously-arisen or vaccine-induced fibrosarcomas in cats is demonstrated. ^
Resumo:
Microcell-mediated chromosome transfer is a method of gene transfer which allows for the introduction of single or small groups of intact chromosomes into recipient host cells. Microcell transfer was first performed by Fournier and Ruddle using rodent microcells and various recipient cells. Expansion of this technology to include the transfer of normal human genetic material has been hindered because large micronucleate populations from diploid human cells have been unobtainable. This dissertation research describes, however, the methods for production of micronuclei in 40-60% of normal human fibroblasts. Once micronucleate cells were obtained, they were enucleated by centrifugation in the presence of Cytochalasin B; the microcells were then purified and fused to recipient mouse (LMTK('-)) cells using a new fusion protocol employing polyethylene glycol containing phytohemagglutinin. Microcell clones were isolated from the HAT selection system. Alkaline Giemsa staining performed on these hybrids indicated the presence of a single human chromosome in each of seven microcell clones from three separate experiments. That chromosome was further identified by G banding analysis to be human chromosome #17, which codes for thymidine kinase. The time course for production of these hybrids from fusion to karyotypic analysis was 6 weeks. The viability of the transferred human genetic material was assessed by electrophoretic isozyme analysis.^ Subsequent experiments were performed in an attempt to optimize the transfer frequency for the thymidine kinase gene using this system. Results indicated that the frequency could be increased from < 1 x 10('-6) in initial experiments to 2 x 10('-5) in the latest experiment. Analyses were also conducted to determine the number of chromosomes per isolated microcell as well as to investigate the stability of the transferred human chromosome in the mouse genome. ^
Resumo:
Treatment of central nervous system (CNS) diseases is limited by the blood-brain barrier (BBB), a selective vascular interface restricting passage of most molecules from blood into brain. Specific transport systems have evolved allowing circulating polar molecules to cross the BBB and gain access to the brain parenchyma. However, to date, few ligands exploiting such systems have proven clinically viable in the setting of CNS diseases. We reasoned that combinatorial phage-display screenings in vivo would yield peptides capable of crossing the BBB and allow for the development of ligand-directed targeting strategies of the brain. Here we show the identification of a peptide mediating systemic targeting to the normal brain and to an orthotopic human glioma model. We demonstrate that this peptide functionally mimics iron through an allosteric mechanism and that a non-canonical association of (i) transferrin, (ii) the iron-mimic ligand motif, and (iii) transferrin receptor mediates binding and transport of particles across the BBB. We also show that in orthotopic human glioma xenografts, a combination of transferrin receptor over-expression plus extended vascular permeability and ligand retention result in remarkable brain tumor targeting. Moreover, such tumor targeting attributes enables Herpes simplex virus thymidine kinase-mediated gene therapy of intracranial tumors for molecular genetic imaging and suicide gene delivery with ganciclovir. Finally, we expand our data by analyzing a large panel of primary CNS tumors through comprehensive tissue microarrays. Together, our approach and results provide a translational avenue for the detection and treatment of brain tumors.
Resumo:
Osseous metastases account for most of the morbidity and mortality associated with prostate cancer, for which there are currently no effective therapies. In the skeletal metastatic environment, neoplastic prostatic epithelial cells interact in a bidirectional stimulatory manner with osteoblastic stromal cells. Similarly, the presence of osteoblastic cells is essential for the survival and maintenance of intraosseous prostate cancer cells. In this thesis, I have developed novel gene therapy strategies for the treatment of androgen-independent human prostate cancers in experimental animal models. First, Ad-CMV-p53, a recombinant adenovirus (Ad) containing p53 tumor suppressor gene driven by the universal cytomegalovirus promoter, was effective in inhibiting prostate cancer cell growth, and direct intratumoral injections of Ad-CMV-p53 resulted in tumor regression. Second, because prostate cancer cells as well as osteoblastic cells produce osteocalcin (OC), OC promoter mediated tissue/tumor specific toxic gene therapy is developed to interrupt stromal-epithelial communications by targeting both cell types. Ad-OC-TK, a recombinant Ad containing the herpes simplex virus thymidine kinase (TK) gene driven by the OC promoter, was generated to inhibit the growth of osteoblastic osteosarcoma with prodrug acyclovir (ACV). Ad-OC-TK/ACV also inhibited the growth of prostate cancer cells and suppressed the growth of subcutaneous and intraosseous prostate tumor. In order to combine treatment modalities to maximize tumor cell-kill with minimized host toxicities, Ad-OC-TK/ACV was applied in combination with low dose methotrexate to eradicate osteoblastic osteosarcoma. In targeting of micrometastatic disease, intravenous Ad-OC-TK/ACV treatment resulted in significant tumor nodule reduction and prolonged the survival of animals harboring osteosarcoma lung metastases without significant host toxicity. Ad-OC-TK is a rational choice for the treatment of prostate cancer skeletal metastasis because OC is uniformly detected in both primary and metastatic human prostate cancer specimens by immunohistochemistry. Ad-OC-TK/ACV inhibits the growth not only of prostate cancer cells but also of their supporting bone stromal cells. Targeting both prostate cancer epithelium and its supporting stroma may be most efficacious for the treatment of prostate cancer osseous metastases. ^
Resumo:
Red Blood cell mediated and glass needle mediated microinjection technology was used to introduce macromolecules into mammalian somatic cells. The biological activities of DNA synthesis inducing factor(s) (Chapter 1), mitotic factor(s) (Chapter 2), and DNA coding for ovalbumin and thymidine kinase (Chapter 3) were studied following injection into mammalian somatic cells.^ Chapter 1. A cell undergoing DNA replication (S phase) contains a factor(s) that induces DNA synthesis prematurely in a G(,1) nucleus when an S phase cell is fused to a G(,1) cell. An assay for the active factor(s) was developed in which a mixture of s phase extract loaded red blood cells (RBC) and synchronous G(,1) HeLa cells was centrifuged onto Concanavalin A (Con A) treated coverslips and fused by PEG. This technique is called "Centrifusion". The synchronous G(,1) HeLa cells injected with S phase extract initiated DNA synthesis earlier than the control G(,1) cells mock injected with RBC loaded with buffer.^ Chapter 2. It has been demonstrated that fusion between a mitotic and an interphase cell usually leads to breakdown of the interphase nucleus, followed by condensation of the interphase chromatin into discrete chromosomes, a process termed premature chromosome condensation. I wanted to develop an assay for the mitotic factor(s) that induces premature chromosome condensation. Experiments were performed utilizing glass needle mediated microinjection of HeLa cell mitotic extract into interphase somatic mammalian cells in an attempt to induce premature chromosome condensation. However, I was not able to induce premature chromosome condensation in the interphase cells, probably because of an inability to introduce sufficient mitotic factor(s) into the cells.^ Chapter 3. A recombinant plasmid containing the chicken ovalbumin gene and three copies of the Herpes thymidine Kinase gene (pOV12-TK) was introduced into mouse LMTK('-) cell nuclei using glass needle mediated gene transfer resulting in LMTK('+) clones that were selected for in HAT medium. Restriction enzyme analysis of the high molecular weight DNA from 6 HAT medium survivor cell clones revealed the presence of one or at best only a few copies of the 12kb ovalbumin gene per mouse genome. Further analysis showed the ovalbumin DNA was not rearranged and was associated with high molecular weight mouse cell DNA. Each of the analyzed cell clones produced ovalbumin demonstrating that the biological activity of the microinjected ovalbumin was retained. ^
Resumo:
Colorectal cancer is the number two cancer killer in the United States. Although primary colorectal cancer can be resected by surgery, patients often die from metastatic disease. Liver is the most common site of metastasis for colorectal cancer. It is difficult to selectively kill metastatic colon cancer cells without damaging normal liver functions. Thus it becomes a high priority to develop a selective targeting system for the treatment of colorectal cancer liver metastasis. ^ In the current study, a gene therapy strategy that allows a therapeutic gene to selectively destroy metastatic colon cancer cells without affecting normal liver cells is developed. The APC gene is frequently mutated in colorectal cancers. These mutations activate β-catenin responsive promoters. An optimized β-catenin responsive promoter, containing TCF consensus binding sites, was engineered for this study. This TCF promoter was found to express preferentially in APC mutated/β-catenin activated colorectal cancers while maintaining a low expression level in cell lines of liver origin. A recombinant adenoviral vector AdTCF-TK, in which the TCF promoter controls expression of the herpes simplex virus thymidine kinase gene, selectively destroyed colorectal cancer cells in vitro. AdTCF-TK virus and ganciclovir treatment also inhibited the growth of solid tumour derived from the colon cancer cell line DLD-1 in nude mice. In a control experiment, the growth inhibition effect of the same virus was attenuated in a liver cancer cell line. ^ In the present study, a novel method was developed to target therapeutic gene expression to colon cancer cells at reduced liver toxicity to the patients. The same gene therapy design may also be applied to treat tumours carrying mutations in the β-catenin gene, which is a central component of the APC signal transduction pathway. In summary, the principle for a rational design of a cancer specific treatment approach is demonstrated in this study. In the future, mutations in cancer patients will be more easily identified. Using the same principle developed in this study, specific regimen can be designed to treat these patients based on the specific genetic changes found in the tumour. ^
Resumo:
The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
The Caenorhabditis elegans germline is an excellent model system for studying meiosis, as the gonad contains germ cells in all stages of meiosis I prophase in a linear temporal and spatial pattern. To form healthy gametes, many events must be coordinated. Failure of any step in the process can reduce fertility. Here, we describe a C. elegans Germinal Center Kinase, GCK-1, that is essential for the accurate progression of germ cells through meiosis I prophase. In the absence of GCK-1, germ cells undergo precocious maturation due to the activation of a specific MAP kinase isoform. Furthermore, GCK-1 localizes to P-bodies, RNP particles that have been implicated in RNA degradation and translational control. Like two other components of C. elegans germline P-bodies, GCK-1 functions to limit physiological germ cell apoptosis. This is the first study to identify a role for a GCK-III kinase in metazoan germ cell development and to link P-body function with MAP kinase activation and germ cell maturation. ^
Resumo:
Overexpression and/or amplification of HER2/neu is frequently detected in many human cancers. Activation of p185 tyrosine kinase can be achieved by point mutation, overexpression, deletion, and heterodimerization with other class I receptors. In this study I investigated the signal transduction pathways mediating the oncogenic signal of the point mutation-activated rat p185. I demonstrated that tyrosine phosphorylation of Shc and formation of Shc/Grb2 complex correlated to the transformation of NIH3T3 cells caused by the point mutation-activated rat HER2/neu. Furthermore, I observed that association with Shc was severely impaired by deletion of most of the major autophosphorylation sites of the point-mutated p185. The truncated p185 product, however, fully retained its ability to transform NIH3T3 cells, induce Shc tyrosine phosphorylation and Shc/Grb2 complex formation. These results suggest that tyrosine phosphorylation of Shc which allows formation of Shc/Grb2 complex may play an important role in cell transformation induced by the point mutation-activated p185, and that stable binding to mutant p185 may not be necessary for Shc to mediate this signaling pathway.^ Recent studies have suggested that formation of the complex containing Sos, Grb2 and Shc is important in coupling receptor tyrosine kinases to the Ras signaling pathway. To clarify the role of this trimer in the oncogenic signaling of the activated p185, I set out to interfere with the protein-protein interactions in Shc/Grb2/Sos complex by introducing Grb2 mutants with deletions in either amino- ($\Delta$N-Grb2) or carboxyl- ($\Delta$C-Grb2) terminal SH3 domains into B104-1-1 cells derived from NIH3T3 cells that express the point mutation-activated HER-2/neu. I found that the transformed phenotypes of the B104-1-1 cells were largely reversed by expression of the $\Delta$N-Grb2. The effect of the $\Delta$C-Grb2 on phenotypic reversion was much weaker. Biochemical analysis showed that the $\Delta$N-Grb2 was able to associate Shc but not the activated p185 nor Sos, while the $\Delta$C-Grb2 bound to Shc, the activated p185, and Sos. The p185-mediated Ras activation was severely inhibited by the $\Delta$N-Grb2 but not the $\Delta$C-Grb2. Taken together, these data demonstrate that interruption of the interaction between Shc and the endogenous Grb2 by the $\Delta$N-Grb2 is able to impair the oncogenic signaling of the mutation-activated p185, indicating that (i) the $\Delta$N-Grb2 functions as a strong dominant-negative mutant, (ii) Shc/Grb2/Sos pathway plays a major role in mediating the oncogenic signal of the mutation-activated p185. Unlike the $\Delta$N-Grb2, the $\Delta$C-Grb2 appears to be a relatively weak dominant-negative mutant, probably due to its ability to largely fulfill the biological functions of the wild-type Grb2. ^
Resumo:
The p21-activated kinase, Shk1, is an essential serine/threonine kinase required for normal cell polarity, proper mating response, and hyperosmotic stress response, in the fission yeast, Schizosaccharomyces pombe. This study has established a novel role for Shk1 as a microtubule regulator in fission yeast and, in addition, characterized a potential biological substrate of Shk1. Cells defective in Shk1 function were found to exhibit malformed interphase and mitotic microtubules, are hypersensitive to the microtubule disrupting drug thiabendazole (TBZ), and are cold sensitive for growth. Microtubule disruption by TBZ results in a significant reduction of Shk1 kinase activity, which is restored after cells are released from the drug, thus providing a correlation between Shk1 kinase activity and active microtubule polymerization. Consistent with a role for Shk1 as a microtubule regulator, GFP-Shk1 fusion proteins localize to interphase microtubules and mitotic microtubule spindles. Furthermore, loss of Tea1, a presumptive microtubule regulator in fission yeast, exacerbates the growth and microtubule defects of cells deficient in Shk1 function, and results in illicit Shk1 localization. Moreover, loss of the Cdc2 inhibitory kinase Wee1, which has been implicated as a mediator of the Shk1 pathway, leads to significant microtubule defects. Intriguingly, Wee1 protein levels are markedly reduced both by partial loss of Shk1 function and by treatment with TBZ. These results suggest that Shk1 is required for proper regulation of microtubule dynamics in fission yeast and may interact with Tea1 and Wee1 in this regulatory process. ^ To further understand Shk1 function in fission yeast, a yeast two-hybrid screen for proteins that interact with the Shk1 catalytic domain was performed. This screen led to the identification of a novel protein, Skb10 (for S&barbelow;hk1 k&barbelow;inase b&barbelow;inding protein 10). Coprecipitation experiments demonstrated that Skb10 associates with Shk1 in S. pombe cells. (Abstract shortened by UMI.) ^
Resumo:
Sox9 is a master transcription factor in chondrocyte differentiation. Several lines of evidence suggest that the p38 mitogen-activated protein kinase (MAPK) pathway is involved in chondrocyte differentiation. In the present study, we examined the roles of p38 in the regulation of SOX9 activity and chondrogenesis. ^ COS7 cells were transfected with a SOX9 expression vector and 4x48-p89, a luciferase construction harboring four tandem copies of a SOX9-dependent 48-bp enhancer in Col2a1. Coexpression of MKK6EE, a constitutively active mutant of MKK6, a MAPKK that specifically activates p38, further increased the activity of the SOX9-dependent 48-bp enhancer about 5-fold, and SOX9 protein levels were not increased under these conditions. This increase in enhancer activity was not observed in a mutant enhancer construct harboring mutations that abolish SOX9 binding. These data strongly suggested that activation of the p38 pathway results in increased activity of SOX9. In addition, the increase of the activity of the SOX9-dependent 48-bp enhancer by MKK6EE was also observed in primary chondrocytes, and this increase was abolished by coexpression of a p38 phosphatase, MKP5, and p38 specific inhibitors. Furthermore, treatment of primary chondrocytes with p38 inhibitors decreased the expression of Col2a1, a downstream target of Sox9, without affecting Sox9 RNA levels, further supporting the hypothesis that p38 plays a role in regulating Sox9 activity in chondrocytes. ^ To further study the role of the p38 MAPK pathway in chondrogenesis, we generated transgenic mice that express MKK6EE in chondrocytes under the control of the Col2a1 promoter/intron regulatory sequences. These mice showed a dwarf phenotype characterized by reduced chondrocyte proliferation and a delay in the formation of primary and secondary ossification centers. Histological analysis using in situ hybridization showed reduced expression of Indian hedgehog, PTH/PTHrP receptor, cyclin D1 and increased expression of p21. In addition, consistent with the notion that Sox9 activity was increased in these mice, transgenic mice that express MKK6EE in chondrocytes showed phenotypes similar to those of mice that overexpress SOX9 in chondrocytes. Therefore, our study provides in vivo evidence for the role of p38 in chondrocyte differentiation and suggests that Sox9 is a downstream target of the p38 MAPK pathway. ^