70 resultados para Thymidine Kinase
em DigitalCommons@The Texas Medical Center
Resumo:
At the fore-front of cancer research, gene therapy offers the potential to either promote cell death or alter the behavior of tumor-cells. One example makes use of a toxic phenotype generated by the prodrug metabolizing gene, thymidine kinase (HSVtk) from the Herpes Simplex Virus. This gene confers selective toxicity to a relatively nontoxic prodrug, ganciclovir (GCV). Tumor cells transduced with the HSVtk gene are sensitive to 1-50 $\mu$M GCV; normal tissue is insensitive up to 150-250 $\mu$M GCV. Utilizing these different sensitivities, it is possible to selectively ablate tumor cells expressing this gene. Interestingly, if a HSVtk$\sp+$ expressing population is mixed with a HSVtk$\sp-$ population at high density, all the cells are killed after GCV administration. This phenomenon for killing all neighboring cells is termed the "bystander effect", which is well documented in HSVtk$\sp-$ GCV systems, though its exact mechanism of action is unclear.^ Using the mouse colon carcinoma cell line CT26, data are presented supporting possible mechanisms of "bystander effect" killing of neighboring CT26-tk$\sp-$cells. A major requirement for bystander killing is the prodrug GCV: as dead or dying CT26tk$\sp+$ cells have no toxic effect on neighboring cells in its absence. In vitro, it appears the bystander effect is due to transfer of toxic GCV-metabolites, through verapamil sensitive intracellular-junctions. Additionally, possible transfer of the HSVtk enzyme to bystander cells after GCV addition, may play a role in bystander killing. A nude mouse model suggests that in a 50/50 (tk$\sp+$/tk$\sp-$) mixture of CT26 cells the bystander eradication of tumors does not involve an immune component. Additionally in a possible clinical application, the "bystander effect" can be directly exploited to eradicate preexisting CT26 colon carcinomas in mice by intratumoral implantation of viable or lethally irradiated CT26tk$\sp+$ cells and subsequent GCV administration. Lastly, an application of this toxic phenotype gene to a clinical marking protocol utilizing a recombinant adenoviral vector carrying the bifunctional protein GAL-TEK to eradicate spontaneously-arisen or vaccine-induced fibrosarcomas in cats is demonstrated. ^
Resumo:
Treatment of central nervous system (CNS) diseases is limited by the blood-brain barrier (BBB), a selective vascular interface restricting passage of most molecules from blood into brain. Specific transport systems have evolved allowing circulating polar molecules to cross the BBB and gain access to the brain parenchyma. However, to date, few ligands exploiting such systems have proven clinically viable in the setting of CNS diseases. We reasoned that combinatorial phage-display screenings in vivo would yield peptides capable of crossing the BBB and allow for the development of ligand-directed targeting strategies of the brain. Here we show the identification of a peptide mediating systemic targeting to the normal brain and to an orthotopic human glioma model. We demonstrate that this peptide functionally mimics iron through an allosteric mechanism and that a non-canonical association of (i) transferrin, (ii) the iron-mimic ligand motif, and (iii) transferrin receptor mediates binding and transport of particles across the BBB. We also show that in orthotopic human glioma xenografts, a combination of transferrin receptor over-expression plus extended vascular permeability and ligand retention result in remarkable brain tumor targeting. Moreover, such tumor targeting attributes enables Herpes simplex virus thymidine kinase-mediated gene therapy of intracranial tumors for molecular genetic imaging and suicide gene delivery with ganciclovir. Finally, we expand our data by analyzing a large panel of primary CNS tumors through comprehensive tissue microarrays. Together, our approach and results provide a translational avenue for the detection and treatment of brain tumors.
Resumo:
Osseous metastases account for most of the morbidity and mortality associated with prostate cancer, for which there are currently no effective therapies. In the skeletal metastatic environment, neoplastic prostatic epithelial cells interact in a bidirectional stimulatory manner with osteoblastic stromal cells. Similarly, the presence of osteoblastic cells is essential for the survival and maintenance of intraosseous prostate cancer cells. In this thesis, I have developed novel gene therapy strategies for the treatment of androgen-independent human prostate cancers in experimental animal models. First, Ad-CMV-p53, a recombinant adenovirus (Ad) containing p53 tumor suppressor gene driven by the universal cytomegalovirus promoter, was effective in inhibiting prostate cancer cell growth, and direct intratumoral injections of Ad-CMV-p53 resulted in tumor regression. Second, because prostate cancer cells as well as osteoblastic cells produce osteocalcin (OC), OC promoter mediated tissue/tumor specific toxic gene therapy is developed to interrupt stromal-epithelial communications by targeting both cell types. Ad-OC-TK, a recombinant Ad containing the herpes simplex virus thymidine kinase (TK) gene driven by the OC promoter, was generated to inhibit the growth of osteoblastic osteosarcoma with prodrug acyclovir (ACV). Ad-OC-TK/ACV also inhibited the growth of prostate cancer cells and suppressed the growth of subcutaneous and intraosseous prostate tumor. In order to combine treatment modalities to maximize tumor cell-kill with minimized host toxicities, Ad-OC-TK/ACV was applied in combination with low dose methotrexate to eradicate osteoblastic osteosarcoma. In targeting of micrometastatic disease, intravenous Ad-OC-TK/ACV treatment resulted in significant tumor nodule reduction and prolonged the survival of animals harboring osteosarcoma lung metastases without significant host toxicity. Ad-OC-TK is a rational choice for the treatment of prostate cancer skeletal metastasis because OC is uniformly detected in both primary and metastatic human prostate cancer specimens by immunohistochemistry. Ad-OC-TK/ACV inhibits the growth not only of prostate cancer cells but also of their supporting bone stromal cells. Targeting both prostate cancer epithelium and its supporting stroma may be most efficacious for the treatment of prostate cancer osseous metastases. ^
Resumo:
Microcell-mediated chromosome transfer is a method of gene transfer which allows for the introduction of single or small groups of intact chromosomes into recipient host cells. Microcell transfer was first performed by Fournier and Ruddle using rodent microcells and various recipient cells. Expansion of this technology to include the transfer of normal human genetic material has been hindered because large micronucleate populations from diploid human cells have been unobtainable. This dissertation research describes, however, the methods for production of micronuclei in 40-60% of normal human fibroblasts. Once micronucleate cells were obtained, they were enucleated by centrifugation in the presence of Cytochalasin B; the microcells were then purified and fused to recipient mouse (LMTK('-)) cells using a new fusion protocol employing polyethylene glycol containing phytohemagglutinin. Microcell clones were isolated from the HAT selection system. Alkaline Giemsa staining performed on these hybrids indicated the presence of a single human chromosome in each of seven microcell clones from three separate experiments. That chromosome was further identified by G banding analysis to be human chromosome #17, which codes for thymidine kinase. The time course for production of these hybrids from fusion to karyotypic analysis was 6 weeks. The viability of the transferred human genetic material was assessed by electrophoretic isozyme analysis.^ Subsequent experiments were performed in an attempt to optimize the transfer frequency for the thymidine kinase gene using this system. Results indicated that the frequency could be increased from < 1 x 10('-6) in initial experiments to 2 x 10('-5) in the latest experiment. Analyses were also conducted to determine the number of chromosomes per isolated microcell as well as to investigate the stability of the transferred human chromosome in the mouse genome. ^
Resumo:
Red Blood cell mediated and glass needle mediated microinjection technology was used to introduce macromolecules into mammalian somatic cells. The biological activities of DNA synthesis inducing factor(s) (Chapter 1), mitotic factor(s) (Chapter 2), and DNA coding for ovalbumin and thymidine kinase (Chapter 3) were studied following injection into mammalian somatic cells.^ Chapter 1. A cell undergoing DNA replication (S phase) contains a factor(s) that induces DNA synthesis prematurely in a G(,1) nucleus when an S phase cell is fused to a G(,1) cell. An assay for the active factor(s) was developed in which a mixture of s phase extract loaded red blood cells (RBC) and synchronous G(,1) HeLa cells was centrifuged onto Concanavalin A (Con A) treated coverslips and fused by PEG. This technique is called "Centrifusion". The synchronous G(,1) HeLa cells injected with S phase extract initiated DNA synthesis earlier than the control G(,1) cells mock injected with RBC loaded with buffer.^ Chapter 2. It has been demonstrated that fusion between a mitotic and an interphase cell usually leads to breakdown of the interphase nucleus, followed by condensation of the interphase chromatin into discrete chromosomes, a process termed premature chromosome condensation. I wanted to develop an assay for the mitotic factor(s) that induces premature chromosome condensation. Experiments were performed utilizing glass needle mediated microinjection of HeLa cell mitotic extract into interphase somatic mammalian cells in an attempt to induce premature chromosome condensation. However, I was not able to induce premature chromosome condensation in the interphase cells, probably because of an inability to introduce sufficient mitotic factor(s) into the cells.^ Chapter 3. A recombinant plasmid containing the chicken ovalbumin gene and three copies of the Herpes thymidine Kinase gene (pOV12-TK) was introduced into mouse LMTK('-) cell nuclei using glass needle mediated gene transfer resulting in LMTK('+) clones that were selected for in HAT medium. Restriction enzyme analysis of the high molecular weight DNA from 6 HAT medium survivor cell clones revealed the presence of one or at best only a few copies of the 12kb ovalbumin gene per mouse genome. Further analysis showed the ovalbumin DNA was not rearranged and was associated with high molecular weight mouse cell DNA. Each of the analyzed cell clones produced ovalbumin demonstrating that the biological activity of the microinjected ovalbumin was retained. ^
Resumo:
Colorectal cancer is the number two cancer killer in the United States. Although primary colorectal cancer can be resected by surgery, patients often die from metastatic disease. Liver is the most common site of metastasis for colorectal cancer. It is difficult to selectively kill metastatic colon cancer cells without damaging normal liver functions. Thus it becomes a high priority to develop a selective targeting system for the treatment of colorectal cancer liver metastasis. ^ In the current study, a gene therapy strategy that allows a therapeutic gene to selectively destroy metastatic colon cancer cells without affecting normal liver cells is developed. The APC gene is frequently mutated in colorectal cancers. These mutations activate β-catenin responsive promoters. An optimized β-catenin responsive promoter, containing TCF consensus binding sites, was engineered for this study. This TCF promoter was found to express preferentially in APC mutated/β-catenin activated colorectal cancers while maintaining a low expression level in cell lines of liver origin. A recombinant adenoviral vector AdTCF-TK, in which the TCF promoter controls expression of the herpes simplex virus thymidine kinase gene, selectively destroyed colorectal cancer cells in vitro. AdTCF-TK virus and ganciclovir treatment also inhibited the growth of solid tumour derived from the colon cancer cell line DLD-1 in nude mice. In a control experiment, the growth inhibition effect of the same virus was attenuated in a liver cancer cell line. ^ In the present study, a novel method was developed to target therapeutic gene expression to colon cancer cells at reduced liver toxicity to the patients. The same gene therapy design may also be applied to treat tumours carrying mutations in the β-catenin gene, which is a central component of the APC signal transduction pathway. In summary, the principle for a rational design of a cancer specific treatment approach is demonstrated in this study. In the future, mutations in cancer patients will be more easily identified. Using the same principle developed in this study, specific regimen can be designed to treat these patients based on the specific genetic changes found in the tumour. ^
Resumo:
The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Mantle cell lymphoma (MCL) is an aggressive B-cell lymphoid malignancy representing 5-10% of all non-Hodgkin’s lymphomas. It is distinguished by the t(11;14)(q13;q32) chromosomal translocation that juxtaposes the proto-oncogene CCND1, which encodes cyclin D1 at 11q13 to the IgH gene at 14q32. MCL patients represent about 6% of all new cases of Non-Hodgkin’s lymphomas per year or about 3,500 new cases per year. MCL occurs more frequently in older adults – the average age at diagnosis is the mid-60s with a male-to-female ratio of 2-3:1. It is typically characterized by the proliferation of neoplastic B-lymphocytes in the mantle zone of the lymph node follicle that have a prominent inclination to disseminate to other lymphoid tissues, bone marrow, peripheral blood and other organs. MCL patients have a poor prognosis because they develop resistance/relapse to current non-specific therapeutic regimens. It is of note that the exact molecular mechanisms underlying the pathogenesis of MCL are not completely known. It is reasonable to anticipate that better characterization of these mechanisms could lead to the development of specific and likely more effective therapeutics to treat this aggressive disease. The type I insulin-like growth factor receptor (IGF-IR) is thought to be a key player in several different solid malignancies such as those of the prostate, breast, lung, ovary, skin and soft tissue. In addition, recent studies in our lab showed evidence to support a pathogenic role of IGF-IR in some types of T-cell lymphomas and chronic myeloid leukemia. Constitutively active IGF-IR induces its oncogenic effects through the inhibition of apoptosis and induction of transformation, metastasis, and angiogenesis. Previous studies have shown that signaling through IGF-IR leads to the vi activation of multiple signaling transduction pathways mediated by the receptor-associated tyrosine kinase domain. These pathways include PI3K/Akt, MAP kinase, and Jak/Stat. In the present study, we tested the possible role of IGF-IR in MCL. Our results demonstrate that IGF-IR is over-expressed in mantle cell lymphoma cell lines compared with normal peripheral blood B- lymphocytes. Furthermore, inhibition of IGF-IR by the cyclolignan picropodophyllin (PPP) decreased cell viability and cell proliferation in addition to induction of apoptosis and G2/M cell cycle arrest. Screening of downstream oncogenes and apoptotic proteins that are involved in both IGF-IR and MCL signaling after treatment with PPP or IGF-IR siRNA showed significant alterations that are consistent with the cellular changes observed after PPP treatment. Therefore, our findings suggest that IGF-IR signaling contributes to the survival of MCL and thus may prove to be a legitimate therapeutic target in the future.
Resumo:
The K1 gene of Kaposi sarcoma-associated herpesvirus (KSHV) encodes a transmembrane glycoprotein bearing a functional immunoreceptor tyrosine-based activation motif (ITAM). Previously, we reported that the K1 protein induced plasmablastic lymphomas in K1 transgenic mice, and that these lymphomas showed enhanced Lyn kinase activity. Here, we report that systemic administration of the nuclear factor kappa B (NF-kappaB) inhibitor Bay 11-7085 or an anti-vascular endothelial growth factor (VEGF) antibody significantly reduced K1 lymphoma growth in nude mice. Furthermore, in KVL-1 cells, a cell line derived from a K1 lymphoma, inhibition of Lyn kinase activity by the Src kinase inhibitor PP2 decreased VEGF induction, NF-kappaB activity, and the cell proliferation index by 50% to 75%. In contrast, human B-cell lymphoma BJAB cells expressing K1, but not the ITAM sequence-deleted mutant K1, showed a marked increase in Lyn kinase activity with concomitant VEGF induction and NF-kappaB activation, indicating that ITAM sequences were required for the Lyn kinase-mediated activation of these factors. Our results suggested that K1-mediated constitutive Lyn kinase activation in K1 lymphoma cells is crucial for the production of VEGF and NF-kappaB activation, both strongly implicated in the development of KSHV-induced lymphoproliferative disorders.
Resumo:
The mitotic kinase Aurora B plays a pivotal role in mitosis and cytokinesis and governs the spindle assembly checkpoint which ensures correct chromosome segregation and normal progression through mitosis. Aurora B is overexpressed in breast and other cancers and may be an important molecular target for chemotherapy. Tumor suppressor p53 is the guardian of the genome and an important negative regulator of the cell cycle. Previously, it was unknown whether Aurora B and p53 had mutual regulation during the cell cycle. A small molecule specific inhibitor of Aurora B, AZD1152, gave us an indication that Aurora B negatively impacted p53 during interphase and mitosis. Here, we show the antineoplastic activity of AZD1152 in six human breast cancer cell lines, three of which overexpress HER2. AZD1152 specifically inhibited Aurora B kinase activity, thereby causing mitotic catastrophe, polyploidy and apoptosis, which in turn led to apoptotic death. Further, AZD1152 administration efficiently suppressed tumor growth in orthotopic and metastatic breast cancer cell xenograft models. Notably, it was found that the protein level of Aurora B kinase declined after inhibition of Aurora B kinase activity. Investigation of the underlying mechanism suggested that AZD1152 accelerated the protein turnover of Aurora B by enhancing its ubiquitination. As a consequence of inhibition of Aurora B, p53 levels were increased in tissue culture and murine models. This hinted at a possible direct interaction between p53 and Aurora B. Indeed, it was found that p53 and Aurora B exist in complex and interact directly during interphase and at the centromere in mitosis. Further, Aurora B was shown to phosphorylate p53 at several serine/threonine residues in the DNA binding domain and these events caused downregulation of p53 levels via ubiquitination mediated by Mdm2. Importantly, phosphorylation of threonine 211 was shown to reduce p53’s transcriptional activity while other phosphorylation sites did not. On a functional level, Aurora B was shown to reduce p53’s capacity to mediate apoptosis in response to the DNA damaging agent, cisplatin. These results define a novel mechanism for p53 inactivation by Aurora B and imply that oncogenic hyperactivation or overexpression of Aurora B may compromise p53’s tumor suppressor function.
Resumo:
Mutations in smooth muscle cell (SMC)-specific isoforms of α-actin and β-myosin heavy chain, two major components of the SMC contractile unit, cause familial thoracic aortic aneurysms leading to acute aortic dissections (FTAAD). To investigate whether mutations in the kinase that controls SMC contractile function (myosin light chain kinase [MYLK]) cause FTAAD, we sequenced MYLK by using DNA from 193 affected probands from unrelated FTAAD families. One nonsense and four missense variants were identified in MYLK and were not present in matched controls. Two variants, p.R1480X (c.4438C>T) and p.S1759P (c.5275T>C), segregated with aortic dissections in two families with a maximum LOD score of 2.1, providing evidence of linkage of these rare variants to the disease (p = 0.0009). Both families demonstrated a similar phenotype characterized by presentation with an acute aortic dissection with little to no enlargement of the aorta. The p.R1480X mutation leads to a truncated protein lacking the kinase and calmodulin binding domains, and p.S1759P alters amino acids in the α-helix of the calmodulin binding sequence, which disrupts kinase binding to calmodulin and reduces kinase activity in vitro. Furthermore, mice with SMC-specific knockdown of Mylk demonstrate altered gene expression and pathology consistent with medial degeneration of the aorta. Thus, genetic and functional studies support the conclusion that heterozygous loss-of-function mutations in MYLK are associated with aortic dissections.
Resumo:
Understanding the principles of calmodulin (CaM) activation of target enzymes will help delineate how this seemingly simple molecule can play such a complex role in transducing Ca (2+)-signals to a variety of downstream pathways. In the work reported here, we use biochemical and biophysical tools and a panel of CaM constructs to examine the lobe specific interactions between CaM and CaMKII necessary for the activation and autophosphorylation of the enzyme. Interestingly, the N-terminal lobe of CaM by itself was able to partially activate and allow autophosphorylation of CaMKII while the C-terminal lobe was inactive. When used together, CaMN and CaMC produced maximal CaMKII activation and autophosphorylation. Moreover, CaMNN and CaMCC (chimeras of the two N- or C-terminal lobes) both activated the kinase but with greater K act than for wtCaM. Isothermal titration calorimetry experiments showed the same rank order of affinities of wtCaM > CaMNN > CaMCC as those determined in the activity assay and that the CaM to CaMKII subunit binding ratio was 1:1. Together, our results lead to a proposed sequential mechanism to describe the activation pathway of CaMKII led by binding of the N-lobe followed by the C-lobe. This mechanism contrasts the typical sequential binding mode of CaM with other CaM-dependent enzymes, where the C-lobe of CaM binds first. The consequence of such lobe specific binding mechanisms is discussed in relation to the differential rates of Ca (2+)-binding to each lobe of CaM during intracellular Ca (2+) oscillations.
Resumo:
The modulation of gene regulation by progesterone (P) and its classical intracellular regulation by progestin receptors in the brain, resulting in alterations in physiology and behavior has been well studied. The mechanisms mediating the short latency effects of P are less well understood. Recent studies have revealed rapid nonclassical signaling action of P involving the activation of intracellular signaling pathways. We explored the involvement of protein kinase C (PKC) in P-induced rapid signaling in the ventromedial nucleus of the hypothalamus (VMN) and preoptic area (POA) of the rat brain. Both the Ca2+-independent (basal) PKC activity representing the activation of PKC by the in vivo treatments and the Ca+2-dependent (total) PKC activity assayed in the presence of exogenous cofactors in vitro were determined. A comparison of the two activities demonstrated the strength and temporal status of PKC regulation by steroid hormones in vivo. P treatment resulted in a rapid increase in basal PKC activity in the VMN but not the POA. Estradiol benzoate priming augmented P-initiated increase in PKC basal activity in both the VMN and POA. These increases were inhibited by intracerebroventricular administration of a PKC inhibitor administered 30 min prior to P. The total PKC activity remained unchanged demonstrating maximal PKC activation within 30 min in the VMN. In contrast, P regulation in the POA significantly attenuated total PKC activity +/- estradiol benzoate priming. These rapid changes in P-initiated PKC activity were not due to changes in PKC protein levels or phosphorylation status.