Roles of mismatch repair proteins in the recognition and processing of DNA interstrand crosslinks in human cells

DNA interstrand crosslinks (ICLs) are among the most toxic type of damage to a cell. Many ICL-inducing agents are widely used as therapeutic agents, e.g. cisplatin, psoralen. A bettor understanding of the cellular mechanism that eliminates ICLs is important for the improvement of human health. However, ICL repair is still poorly understood in mammals. Using a triplex-directed site-specific ICL model, we studied the roles of mismatch repair (MMR) proteins in ICL repair in human cells. We are also interested in using psoralen-conjugated triplex-forming oligonucleotides (TFOs) to direct ICLs to a specific site in targeted DNA and in the mammalian genomes. ^ MSH2 protein is the common subunit of two MMR recognition complexes, and MutSα and MutSβ. We showed that MSH2 deficiency renders human cell hypersensitive to psoralen ICLs. MMR recognition complexes bind specifically to triplex-directed psoralen ICLs in vitro. Together with the fact that psoralen ICL-induced repair synthesis is dramatically decreased in MSH2 deficient cell extracts, we demonstrated that MSH2 function is critical for the recognition and processing of psoralen ICLs in human cells. Interestingly, lack of MSH2 does not reduce the level of psoralen ICL-induced mutagenesis in human cells, suggesting that MSH2 does not contribute to error-generating repair of psoralen ICLs, and therefore, may represent a novel error-free mechanism for repairing ICLs. We also studied the role of MLH1, anther key protein in MMR, in the processing of psoralen ICLs. MLH1-deficient human cells are more resistant to psoralen plus UVA treatment. Importantly, MLH1 function is not required for the mutagenic repair of psoralen ICLs, suggesting that it is not involved in the error-generating repair of this type of DNA damage in human cells. ^ These are the first data indicating mismatch repair proteins may participate in a relatively error-free mechanism for processing psoralen ICL in human cells. Enhancement of MMR protein function relative to nucleotide excision repair proteins may reduce the mutagenesis caused by DNA ICLs in humans. ^ In order to specifically target ICLs to mammalian genes, we identified novel TFO target sequences in mouse and human genomes. Using this information, many critical mammalian genes can now be targeted by TFOs.^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

G -rich oligodeoxyribonucleotides: Triplexes and transcription

Formation of a triple helix resulting from oligonucleotide binding to the DNA double helix offers new possibilities to control gene expression at the transcriptional level. Purine-motif triplexes can be formed under physiological pH. Nevertheless, this formation was inhibited by certain monovalent cations during the association but not during dissociation. Since triplexes are very stable, it was possible to assemble them in the absence of KCl and have them survive throughout the course of an in vitro transcription reaction. As for the design of a better triplex-forming oligonucleotide, 12 nucleotides in length afforded the highest binding affinity. G/T-rich oligonucleotides can be very polymorphic in solution. The conditions for forming purine-motif triplexes, duplexes or G-quartets were determined. Understanding these parameters will be important for the practical use of G-rich oligonucleotides in the development of DNA aptamers where the structure of the oligonucleotide is paramount in dictating its function. Finally, purine-motif triplexes were demonstrated to significantly inhibit gene transcription in vitro. The optimal effect on this process was dependent on the location of triplexes within the promoter, i.e., whether upstream or proximally downstream of the transcription start site. The mechanism for the inhibition of transcription appeared to be interference with initiation through preventing engagement by RNA polymerase. This finding is revolutionary when compared to the conventional model where triplexes inhibit transcription only by occluding binding by trans-acting proteins. Our findings broaden the utility of triplexes and support a strategy for antigene therapy by triplexes. ^