Prime-boost vaccination with plasmid and adenovirus gene vaccines control HER2/neu+ metastatic breast cancer in mice.

INTRODUCTION: Once metastasis has occurred, the possibility of completely curing breast cancer is unlikely, particularly for the 30 to 40% of cancers overexpressing the gene for HER2/neu. A vaccine targeting p185, the protein product of the HER2/neu gene, could have therapeutic application by controlling the growth and metastasis of highly aggressive HER2/neu+ cells. The purpose of this study was to determine the effectiveness of two gene vaccines targeting HER2/neu in preventive and therapeutic tumor models. METHODS: The mouse breast cancer cell line A2L2, which expresses the gene for rat HER2/neu and hence p185, was injected into the mammary fat pad of mice as a model of solid tumor growth or was injected intravenously as a model of lung metastasis. SINCP-neu, a plasmid containing Sindbis virus genes and the gene for rat HER2/neu, and Adeno-neu, an E1,E2a-deleted adenovirus also containing the gene for rat HER2/neu, were tested as preventive and therapeutic vaccines. RESULTS: Vaccination with SINCP-neu or Adeno-neu before tumor challenge with A2L2 cells significantly inhibited the growth of the cells injected into the mammary fat or intravenously. Vaccination 2 days after tumor challenge with either vaccine was ineffective in both tumor models. However, therapeutic vaccination in a prime-boost protocol with SINCP-neu followed by Adeno-neu significantly prolonged the overall survival rate of mice injected intravenously with the tumor cells. Naive mice vaccinated using the same prime-boost protocol demonstrated a strong serum immunoglobulin G response and p185-specific cellular immunity, as shown by the results of ELISPOT (enzyme-linked immunospot) analysis for IFNgamma. CONCLUSION: We report herein that vaccination of mice with a plasmid gene vaccine and an adenovirus gene vaccine, each containing the gene for HER2/neu, prevented growth of a HER2/neu-expressing breast cancer cell line injected into the mammary fat pad or intravenously. Sequential administration of the vaccines in a prime-boost protocol was therapeutically effective when tumor cells were injected intravenously before the vaccination. The vaccines induced high levels of both cellular and humoral immunity as determined by in vitro assessment. These findings indicate that clinical evaluation of these vaccines, particularly when used sequentially in a prime-boost protocol, is justified.

Targeting of {\it HER\/}-{\it 2\/}/{\it neu\/} with E1A gene therapy

Amplification or overexpression of HER-2/neu has been demonstrated in human cancers of the ovary, breast, lung and correlated with chemoresistance and poor clinic prognosis. We have previously found that the adenovirus type 5 early region 1A (E1A) gene product can repress the overexpression and suppress the tumorigenic potential of HER-2/neu-overexpressing cancer cells. In addition, E1A has been reported to induce apoptosis and inhibit the metastatic potential of tumor cells. Therefore, E1A could be considered as a tumor suppressor gene in HER-2/neu-overexpressing cancer cells. To develop an efficient HER-2/neu-targeting gene therapy with E1A, adenoviral vector or cationic liposome was used to introduce E1A into human ovarian, breast and lung cancer cells. Successful therapeutic effects were achieved.^ A replication-deficient adenovirus containing the E1A gene, Ad.E1A(+), was used to infect HER-2/neu-overexpressing human ovarian cancer cell line. Ovarian cancer growth in vitro and colony formation in soft agarose were greatly inhibited.^ To examine tumor suppressor function of E1A in breast cancer, we introduced E1A in vitro by adenovirus into both HER-2/neu-overexpressing and low-expressing human breast cancer cell lines. In HER-2/neu-overexpressing cells, E1A greatly inhibited tumor cell growth in vitro and colony formation in soft agarose. However, in low HER-2/neu expressing cancer cell lines, E1A could only reduce colony formation in soft agarose but had no significant effect on cell growth in monolayer, indicating different effects of E1A in these two types of cancer cells. To test the local therapeutic efficacy of E1A, we used either adenovirus- or liposome-mediated E1A gene delivery systems in an orthotopic breast cancer animal model.^ To test the therapeutic efficacy of systemically-delivered E1A in vivo lung cancer, we treated mice bearing intratracheal lung cancer by i.v. tail injections of Ad.E1A(+). As a result, Ad.E1A(+) suppressed HER-2/neu overexpression and inhibited intratracheal lung cancer growth. However, no significant tumor suppression effect of Ad.E1A(+) was observed in mice bearing HER-2/neu low expressing cell line when the same therapeutic procedure was followed. (Abstract shortened by UMI.) ^

Prime and boost vaccination against HER2/neu in breast cancer

Breast cancer is the most common cancer among women with approximately 180,000 new cases being diagnosed yearly in the United States (1). HER2/neu gene amplification and subsequent protein overexpression is found in 20–30% of breast cancer patients and can lead to the promotion of various metastasis-related properties (2–4) and/or resistance to cancer therapies such as chemotherapy and radiation (5). ^ The protein product of the HER2/neu gene, p185, is a proven target for immunological therapy. Recently, passive immunotherapy with the monoclonal antibody Trastuzumab® has validated an immunological approach to HER2/neu+ breast cancer. Immunity to HER2/ neu, when found in breast cancer patients, is of low magnitude. Vaccination-induced HER2/neu-specific antibodies and HER2/neu-specific cytotoxic T cells could result in long-lived immunity with therapeutic benefit. Many features of DNA vaccines and attenuated viral vectors may contribute to the efficacy of prime-boost vaccination. In particular, vaccines capable of eliciting strong cell-mediated immunity are thought to hold the greatest promise for control of cancer (6–9). ^ To optimize cellular immunization to HER2/neu in my study, the HER2/neu gene was presented to the immune system using a priming vector followed by a second vector used as the boost. In both animals and humans, priming with DNA and boosting with a poxviruses, vaccinia or canarypox appears to be particularly promising for induction of a broad immune responses (10). ^ I tested three gene vaccines encoding the HER2/neu gene: (1) a plasmid, SINCP, that contains part of the genome of Sindbis virus; (2) Viral Replicon Particles (VRP) of Venezuela Equine Encephalitis virus (VEE) and (3) E1/E2a-deleted human Type 5 Adenovirus. In SINCP and the VRP, the caspid and envelope genes of the virus were deleted and replaced with the gene for HER2/neu. SINCP-neu, VRP- neu and Adeno-neu when used alone were effective vaccines protecting healthy mice from challenge with a breast cancer cell line injected in the mammary fat pad or injected i.v. to induce experimental lung metastasis. However, SINCP-neu, VRP-neu or Adeno-neu when used alone were not able to prolong survival of mice in therapeutic models in which vaccination occurred after injection of a breast cancer cell line. ^ When the vaccines were combined in a mixed regimen of a SINCP- neu prime VRP-neu or Adeno-neu boost, there was a significant difference in tumor growth and survival in the therapeutic vaccine models. In vitro assays demonstrated that vaccination with each of the three vaccines induced IgG specific for p185, the gene product of HER2/neu, induced p185-specific T lymphocytes, as measured by tetramer analysis. Vaccination also induced intracellular INF-γ and a positive ELISPOT assay. These findings indicate that SINCP-neu, VRP-neu and Adeno-neu, used alone or in combination, may have clinical potential as adjuvant immunotherapy for the treatment of HER2/neu-expressing tumors. ^

Proliferation index in ductal carcinoma in situ of the breast: Relation to estrogen, progesterone and HER2/neu receptors

Background. Ductal carcinoma in situ (DCIS) is the most prevalent precursor to invasive breast cancer (IBC), the second leading cause of death in women in the United States. The three most important prognostic markers for IBC are Estrogen receptor (ER), Progesterone receptor (PR) and HER2/neu. The four groups (IBC) defined as (1) ER and/or PR positive and HER2/neu negative, (2) ER and/or PR positive and HER2/neu positive (3) ER and/or PR negative and HER2/neu positive and (4) negative for all three of these receptors (Triple negative). However, they have not been well studied in DCIS. This is an exploratory study with a primary objective to examine the prevalence of ER, PR, and HER2/neu in DCIS, to explore if the defined groups of IBC occur in DCIS and to consider the biological relationship between these four groups and the proliferative activity of the tumor. A secondary goal of this study is to examine the relationship between grade and proliferative activity. Methods. Using immunohistochemistry, I have measured Ki-67, ER, PR and HER2/neu positivity for a series of cases of DCIS. Results. 20 ER and/or PR positive and HER2/neu negative (50%) with average PI of 0.05, 7 ER and/or PR positive and HER2/neu positive (17.5%) with average PI of 0.14, 10 ER and/or PR negative and HER2/neu positive (25%) with average PI of 0.18, and three triple negative (7.5%) with average PI of 0.18. ER and/or PR positive and HER2/neu positive group has the highest PI (p<0.001). Further, the ER and/or PR positive and HER2/neu positive group show a linear relationship between PI and average ER/PR positivity (R=0.6). PI increases with higher grades. Conclusion. PI appears to depend upon the average fraction of positive ER/PR tumor cells, possibly with a synergistic dependence when HER2/neu is positive. If ER/PR is negative, then both HER2/neu positive and the triple negative cases appear to cluster around an average PI that is higher than the average PI in HER2/neu negative ER/PR positive negative cases. In the triple negative tumors there must be another driver of proliferation.^

Transcriptional regulation of the {\it neu\/} oncogene and its negative regulation by the c-{\it myc\/} oncogene

The first part of my research involved the characterization of the neu gene promoter. I subcloned a 2.2-kb sequence located upstream to the extreme 5$\sp\prime$ end of the neu gene, in front of the bacterial reporter gene, chloramphenicol acetyltransferase (CAT). Transfection of this construct into different cell lines and subsequent CAT assays demonstrated that this 2.2-kb fragment was functional as a promoter. A series of deletion constructs was engineered to study the contribution of different fragments to transcription. Subcloning of individual fragments was followed by a cotransfection competition experiment, which demonstrated the involvement of protein factors interacting with the promoter. A gel retardation assay was also performed to show the physical binding of protein factors to the promoter. The combined results suggested that both positively and negatively acting protein factors are involved in interacting with different regions of the promoter, contributing to the overall transcription activity. My findings provide an insight into the regulation of neu gene expression, which in turn provides the tools to understand the molecular mechanisms of overexpression of the neu gene in some breast cancer and ovarian cancer cell lines.^ In the second part of my research, I discovered that another oncogene, c-myc, was able to reverse the transformed morphology that was induced by the neu oncogene. Utilizing the promoter constructs that I made, I was able to show that the c-myc oncogene has a negative regulatory effect on the expression of the neu oncogene. Further studies suggested that c-myc is able to lower the effective concentration of a positive factor(s) that interact with a 139-bp fragment of the neu gene promoter. These findings may provide a direct evidence of the long suspected role of the c-myc gene in transcriptional regulation. The neu gene may very well be the first identified mammalian target gene that is regulated by the c-myc oncogene. Since c-myc is known to be stimulated by various mitogenic signals and the neu gene is likely to be a growth factor receptor, it is possible that c-myc, when stimulated by the signal transduction pathway of the neu gene, would function as a negative feedback regulator on the neu gene receptor. (Abstract shortened with permission of author.) ^

The transcriptional regulation of the {\it neu\/} gene: Examples of activation, repression, and cell-specific expression

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Repression of {\it neu} oncogene by E1A: Mechanisms and biological functions

The potential effects of the E1A gene products on the promoter activities of neu were investigated. Transcription of the neu oncogene was found to be strongly repressed by the E1A gene products and this requires that conserved region 2 of the E1A proteins. The target for E1A repression was localized within a 140 base pair (bp) DNA fragment in the upstream region of the neu promoter. To further study if this transcriptional repression of neu by E1A can inhibit the transforming ability of the neu transformed cells, the E1A gene was introduced into the neu oncogene transformed B104-1-1 cells and developed B-E1A cell lines that express E1A proteins. These B-E1A stable transfectants have reduced transforming activity compared to the parental B104-1-1 cell line and we conclude that E1A can suppress the transformed phenotypes of the neu oncogene transformed cells via transcriptional repression of neu.^ To study the effects of E1A on metastasis, we first introduced the mutation-activated rat neu oncogene into 3T3 cells and showed that both the neu oncogene transformed NIH3T3 cells and Swiss Webster 3T3 cells exhibited metastatic properties in vitro and in vivo, while their parental 3T3 cells did not. Additionally, the neu-specific monoclonal antibody 7.16.4, which can down regulate neu-encoded p185 protein, effectively reduced the metastatic properties induced by neu. To investigate if E1A can reduce the metastatic potential of neu-transformed cells, we also compared the metastatic properties of B-E1A cell lines and B104-1-1 cell. B-E1A cell lines showed reduced invasiveness and lung colonization than the parental neu transformed B104-1-1 cells. We conclude that E1A gene products also have inhibitory effect on the metastatic phenotypes of the neu oncogene transformed cells.^ The product of human retinoblastoma (RB) susceptibility gene has been shown to complex with E1A gene products and is speculated to regulate gene expression. We therefore investigated in E1A-RB interaction might be involved in the regulation of neu oncogene expression. We found that the RB gene product can decrease the E1A-mediated repression of neu oncogene and the E1A binding region of the RB protein is required for the derepression function. ^

Autoregulation of the {\it neu\/} oncogene

The neu gene encodes a 185,000-Da membrane glycoprotein that is highly homologous to epidermal growth factor receptor. It is frequently overexpressed or amplified in human breast carcinomas and ovarian cancers, which correlates with a poor prognosis for patients. The importance of neu gene regulation is noted by the fact that many breast cancer cells overexpress the neu gene without proportional gene amplification. The mechanism for that is unclear. My initial finding of neu autoregulation led to a realization that defects in neu autoregulation pathway may contribute to neu overexpression in tumor cells. I have found in the nontransformed NIH 3T3 model system that (i) the neu gene product autorepresses its own promoter activity, (ii) the neu gene promoter contains a novel enhancer, (iii) neu autorepression is mediated through this enhancer by inhibition of the enhancer activity, and (iv) c-myc expression serves as an intermediate step downstream from the membrane bound neu-encoded receptor in this complicated feedback inhibition pathway.^ In addition, a part of my research is studying the neu-encoded receptor molecule. I have generated a construct coding the neu ligand-binding domain and demonstrated that (i) the neu ligand-binding domain is a secretory peptide, (ii) it inhibits the normal neu-associated tyrosine kinase but not activated neu-associated tyrosine kinase. My study provided experimental evidence for the mechanisms of neu gene activation. ^

Regulation of {\it neu\/} gene expression by the simian virus 40 large T antigen and tumor suppressors Rb and p53

The neu gene (also c-erbB-2 or HER2) encodes a 185 kilodalton protein that is frequently overexpressed in breast, ovarian and non-small cell lung cancers. Study of the regulation of neu indicates that neu gene expression can be modulated by c-myc or by the adenovirus 5 E1a gene product. This study demonstrates that the transforming protein, large T antigen, of the simian virus 40 represses neu promoter activity. Repression of neu by large T antigen is mediated through the region $-$172 to $-$79 (relative to first ATG) of the neu promoter--unlike through $-$312 to $-$172 for c-myc or E1a. This suggests a different pathway for repression of neu by large T antigen. The 10 amino acid region of large T required for binding the tumor suppressor, retinoblastoma gene product, Rb, is not necessary for repression of neu. Moreover, the tumor suppressors, Rb and p53 can independently inhibit neu promoter activity. Rb inhibits neu through a 10 base pair G-rich enhancer (GTG element) ($-$243 to $-$234) and also through regions close to transcription initiation sites ($-$172 to $-$79). Mutant Rb unable to complex large T is able to repress the region close to transcription initiation but not the GTG enhancer. Thus, Rb inhibits the two regulatory domains of the neu gene by different mechanisms. Both Rb and p53 can repress the transforming activity of activated neu in focus forming assays. These data provide evidence that tumor suppressors regulate expression of growth stimulatory genes such as neu. Therefore, one reason for the overexpression of neu that is frequently seen in breast cancer cells may be due to functional inactivation of Rb and p53 which is also a common occurrence in breast cancer cells. ^

Transformation studies of a nontumorigenic rat prostatic epithelial cell line with activated {\it myc\/} and {\it neu\/} oncogenes

A cloned nontumorigenic prostatic epithelial cell line, NbE-1.4, isolated from Noble (nbl/crx) rat ventral prostate, was used to examine the potential role of activated myc and neu oncogenes in prostate carcinogenesis. Transfection of SV40 promoter/enhancer driven constructs containing either v-myc, truncated c-myc, or neu-T (activated neu) oncogenes was accomplished using calcium phosphate-mediated DNA transfer. Cells were cotransfected, as necessary, with pSV2neo, allowing for selection of positive clones using the antibiotic geneticin (G418). G418 resistant colonies were pooled in some cases or limiting dilution exclusion cloned in others as described. Transfection of NbE-1.4 cells with activated myc oncogenes resulted only in the partial transformation. These cells display an altered morphology and decreased dependence on serum factors in vitro; however, saturation density, soft agar colony formation and growth assay in male athymic nude mice were all negative. Transfection and overexpression of NbE-1.4 cells with an activated neu oncogene alone resulted in tumorigenic conversion. Cell transformation was evident following an examination of the altered cellular morphology, an increased soft agar colony formation, and an acquisition of a tumorigenic potential when injected s.c. into male athymic nude mice. neu-transformed NbE-1.4 cells displayed elevated activity of the neu receptor tyrosine kinase. Furthermore, qualitative changes in tyrosine phosphorylated proteins were found in neu transformed cell clones. These changes were associated with elevated expression of mRNAs for laminin $\beta$1, $\beta$2, and procollagen type IV. The expression of fibronectin and E-cadherin, which are often lost during tumorigenesis, did not correlate with the tumorigenic phenotype. Therefore, it appears that neu oncogene overexpression has been found to be associated with the transformation of rat prostatic epithelial cells, presumably through alterations in gene expression that regulate extracellular matrix. The possible interrelationship and functional significance between neu oncogene expression and the elevated extracellular matrix gene expression is discussed. ^

Regulation of the {\it neu\/} oncogene by the GTG element binding proteins

A previous study in our lab has shown that the transforming neu oncogene ($neu\sp\*$) was able to initiate signals that lead to repression of the neu promoter activity. Further deletion mapping of the neu promoter identified that the GTG element (GGTGGGGGGG), located between $-$243 and $-$234 relative to the translation initiation codon, mediates such a repression effect. I have characterized the four major protein complexes that interact with this GTG element. In situ UV-crosslinking indicated that each complex contains proteins of different molecular weights. The slowest migrating complex (S) contain Sp1 or Sp1-related proteins, as indicated by the data that both have similar molecular weights, similar properties in two affinity chromatographies, and both are antigenically related in gel shift analysis. Methylation protection and interference experiments demonstrated these complexes bind to overlapping regions of the GTG element. Mutations within the GTG element that either abrogate or enhance complex S binding conferred on the neu promoter with lower activity, indicating that positive factors other than Sp1 family proteins also contribute to neu promoter activity. A mutated version (mutant 4) of the GTG element, which binds mainly the fastest migrating complex that contains a very small protein of 26-kDa, can repress transcription when fused to a heterologous promoter. Further deletion and mutation studies suggested that this GTG mutant and its binding protein(s) may cooperate with some DNA element within a heterologous promoter to lock the basal transcription machinery; such a repressor might also repress neu transcription by interfering with the DNA binding of other transactivators. Our results suggest that both positive and negative trans-acting factors converge their binding sites on the GTG element and confer combinatorial control on the neu gene expression. ^

Mechanisms of HER2/{\it neu\/} proto-oncogene overexpression in breast cancer cells

Overexpression and amplification of HER2/neu have been documented in many primary tumors, most notably in breast. Not only do approximately 30% of breast cancer patients carry tumors that overexpress the gene, but those that do generally have shorter overall and disease-free survival times than patients with tumors expressing low levels of HER2/neu. Thus, overexpression of HER2/neu plays an important role in the pathogenesis of breast cancer. We have examined the mechanisms that result in HER2/neu overexpression in breast cancer by using, as a model system, established breast cancer cell lines that express much higher levels of HER2/neu mRNA than normal breast tissue while maintaining a near normal HER2/neu gene copy number. Nuclear run-on experiments indicate that the breast cancer cell lines MDA-MB453, BT483, and BT474 have an increased HER2/neu gene transcription rate. By using HER2/neu promoter-CAT constructs, we have found that the enhanced HER2/neu transcription rate in MDA-MB453 cells is due to activation of the gene in trans, while the enhanced transcription rate in BT483 cells is due to activation of the gene in either trans or cis. In BT474 cells, transcriptional upregulation is primarily due to gene amplification. Since the levels of increased transcription are not as high as the levels of HER2/neu mRNA in any of these three lines, post-transcriptional deregulation that increases HER2/neu expression must also be functioning in these cells. The half-life of HER2/neu mRNA was measured and found to be equivalent in these lines as in a control. Thus, the post-transcriptional deregulation is not increased stability of the HER2/neu transcript.^ Much work has been performed in characterizing the altered trans-acting factor involved in increased HER2/neu transcription in MDA-MB453 cells. Using promoter deletion constructs linked to a reporter gene, the region responsive to this factor was localized in the rat neu promoter. When human HER2/neu promoter constructs were used, the homologous sequence in the human promoter was identified. Furthermore, a number of protein/DNA complexes are detected when these promoter regions are used in gel mobility shift assays. UV-crosslinking experiments indicate DNA-binding proteins of roughly 110 kDa, 70 kDa, and 35 kDa are capable of interacting with the human promoter element. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Isolation and characterization of revertant cell lines expressing oncogenic rat {\it neu\/}

The neu gene encodes the transmembrane tyrosine kinase growth factor receptor, p185. To study neu induced cellular transformation, we developed revertant cells from the neu transformed NIH 3T3 cell line, B104-1-1, by treating the cells with the chemical mutagen ethylmethane sulfonate. The morphologically normal revertant cells were first selected by their ability to either attach to culture plates or survive in the presence of the cytotoxic reagents colchicine or 5-fluoro-2deoxyuridine. Two of the 21 candidate revertant cell lines isolated were further characterized and were found to lose their anchorage independence and ability to grow in 1% calf serum, indicating that they were nontransformed even though they still expressed p185 oncoprotein. The tyrosine residues of p185 in these two revertants were underphosphorylated, which may have contributed to their nontransformed status. Also, the p185 oncoprotein lacked significant tyrosine kinase activity. In addition, these revertants also resisted transformation by neu and several additional oncogenes (H-ras, N-ras, v-mos, v-abl, and v-fos) as determined by focus forming assays. These results indicated that we had successfully developed, from neu transformed cells, revertants which exhibited defective tyrosine phosphorylation and kinase activity of the neu oncoprotein. The results also suggested that neu and several other oncogenes may share common elements in their pathways for the induction of cellular transformation. ^

Signal transduction of {\it HER-2\/}/{\it neu\/} receptor tyrosine kinase

Overexpression and/or amplification of HER2/neu is frequently detected in many human cancers. Activation of p185 tyrosine kinase can be achieved by point mutation, overexpression, deletion, and heterodimerization with other class I receptors. In this study I investigated the signal transduction pathways mediating the oncogenic signal of the point mutation-activated rat p185. I demonstrated that tyrosine phosphorylation of Shc and formation of Shc/Grb2 complex correlated to the transformation of NIH3T3 cells caused by the point mutation-activated rat HER2/neu. Furthermore, I observed that association with Shc was severely impaired by deletion of most of the major autophosphorylation sites of the point-mutated p185. The truncated p185 product, however, fully retained its ability to transform NIH3T3 cells, induce Shc tyrosine phosphorylation and Shc/Grb2 complex formation. These results suggest that tyrosine phosphorylation of Shc which allows formation of Shc/Grb2 complex may play an important role in cell transformation induced by the point mutation-activated p185, and that stable binding to mutant p185 may not be necessary for Shc to mediate this signaling pathway.^ Recent studies have suggested that formation of the complex containing Sos, Grb2 and Shc is important in coupling receptor tyrosine kinases to the Ras signaling pathway. To clarify the role of this trimer in the oncogenic signaling of the activated p185, I set out to interfere with the protein-protein interactions in Shc/Grb2/Sos complex by introducing Grb2 mutants with deletions in either amino- ($\Delta$N-Grb2) or carboxyl- ($\Delta$C-Grb2) terminal SH3 domains into B104-1-1 cells derived from NIH3T3 cells that express the point mutation-activated HER-2/neu. I found that the transformed phenotypes of the B104-1-1 cells were largely reversed by expression of the $\Delta$N-Grb2. The effect of the $\Delta$C-Grb2 on phenotypic reversion was much weaker. Biochemical analysis showed that the $\Delta$N-Grb2 was able to associate Shc but not the activated p185 nor Sos, while the $\Delta$C-Grb2 bound to Shc, the activated p185, and Sos. The p185-mediated Ras activation was severely inhibited by the $\Delta$N-Grb2 but not the $\Delta$C-Grb2. Taken together, these data demonstrate that interruption of the interaction between Shc and the endogenous Grb2 by the $\Delta$N-Grb2 is able to impair the oncogenic signaling of the mutation-activated p185, indicating that (i) the $\Delta$N-Grb2 functions as a strong dominant-negative mutant, (ii) Shc/Grb2/Sos pathway plays a major role in mediating the oncogenic signal of the mutation-activated p185. Unlike the $\Delta$N-Grb2, the $\Delta$C-Grb2 appears to be a relatively weak dominant-negative mutant, probably due to its ability to largely fulfill the biological functions of the wild-type Grb2. ^