Cloning and characterization of the mouse ret finger protein (rfp), a B box zinc finger protein

An important question in biology is to understand the role of specific gene products in regulating embryogenesis and cellular differentiation. Many of the regulatory proteins possess specific motifs, such as the homeodomain, basic helix-loop-helix structure, zinc finger, and leucine zipper. These sequence motifs participate in specific protein-DNA, protein-RNA, and protein-protein interactions, and are important for the function of these regulatory proteins.^ The human rfp (ret finger protein) belongs to a novel zinc finger protein family, the B box zinc finger family. Most of the B box proteins, including rfp, have a conserved tripartite motif, consisting of two novel zinc fingers (the RING finger and the B box) and a coiled-coil domain. Interestingly, a fusion protein between the tripartite motif of rfp and the tyrosine kinase domain of c-ret has transforming activity. In this study, we examined the expression of rfp during mouse development, and characterized the role of the tripartite motif in rfp function.^ We cloned the mouse rfp cDNA, which shares a 98.4% homology with the human sequence at amino acid level. Such strikingly high degree of homology indicates the high evolutionary pressure on the conservation of the sequence, suggesting that rfp may have an important function. Using the somatic cell hybrid system, we assigned the rfp gene to mouse chromosome 13 and human chromosome 6. Rfp transcripts and protein were ubiquitous in day 10.5-13.5 mouse embryos; however, they were restricted in adult mice, with the highest level of expression in the testis. Rfp expression in the testis is detected only in late pachytene spermatocytes and round spermatids. In both embryos and spermatogenic cells, rfp protein was distributed within cell nuclei in a punctate pattern, similar to the PODs (PML oncogenic domains) observed with another B box protein, PML. In cultured mammalian cells, we found that rfp was indeed co-localized to the PODs with PML. Using the yeast two-hybrid system, we showed that the rfp could specifically interact with PML, and that the interaction was dependent on the distal portion of the rfp coiled-coil domain.^ We also showed that rfp could form homodimers, and both the B box and coiled-coil domain were required for proper dimerization. It seems that the proximal portion of the coiled-coil domain provides the interacting interface, while the B box zinc finger orients the coil and maintains the correct structure of the whole molecule. Our data are consistent with the zinc-binding property and structural analysis of the B box. The RING finger seems to be involved in rfp nuclear localization through interaction with other proteins. We believe that homodimerization and interaction with PML are important for the normal interaction of rfp during development and differentiation. In addition, rfp homodimerization may also be essential for the oncogenic activation of the rfp-ret fusion protein. ^

The transcriptional regulation of the {\it neu\/} gene: Examples of activation, repression, and cell-specific expression

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

ELUCIDATING THE ROLE OF CD44 EXPRESSION ON MESENCHYMAL STEM CELLS WITHIN THE TUMOR MICROENVIRONMENT

The tumor microenvironment is comprised of a vast array of heterogeneous cells including both normal and neoplastic cells. The tumor stroma recruitment process has been exploited for an effective gene delivery technique using bone marrow derived MSC. Targeted migration of the MSC toward the tumor microenvironment, while successful, is not yet fully understood. This study was designed to assess the role of CD44 in the migration of MSC toward the tumor microenvironment and to determine the implications of CD44-deficient MSC within the tumor stroma. Inhibition of MSC migration was evaluated through a variety of methods in vitro and in vivo including CD44 receptor knockdown, CD44 antagonists, CD44 neutralizing antibodies and small molecule inhibitor of matrix metalloproteinases. Blocking CD44 signaling through MMP inhibition was characterized by lack of intracellular domain cleavage and lead to the decrease in Twist gene expression. A functional relationship between CD44 and Twist expression was confirmed by chromatin immunoprecipitation. Next, a series of murine tumor models were used to examine the role of CD44 deficient stroma within the tumor microenvironment. Labeled transgenic CD44 knockout (KO) MSC or wild type (WT) C57/B6 MSC were used to analyze the stromal incorporation within murine breast carcinomas (EO771 and 4T1). Subsequent tumors were analyzed for vessel formation (CD31), and the presence of tumor associated fibroblast (TAF) markers, α-smooth muscle actin (α-SMA), fibroblast activation protein (FAP), and fibroblast specific protein (FSP). The tumors with CD44KO MSC cells had less vessel formation than the tumors with WT MSC. The lack of fibroblastic TAF population as defined by FAP/FSP expression by the CD44KO MSC admixed tumors suggest that the bone marrow derived population of MSC were unable to contribute to the fibroblastic stromal population. Subsequently, a bone marrow transplantation experiment confirmed the endogenous migratory deficiencies of the CD44KO bone marrow derived stromal cells toward the tumor microenvironment in vivo. WT mice with CD44KO bone marrow had less CD44KOderived tumor stroma compared to mice with WT bone marrow. These results indicate that CD44 is crucial to stromal cell migration and incorporation to the tumor microenvironment as TAF.

Do binucleate cardiomyocytes have a role in myocardial repair? Insights using isolated rodent myocytes and cell culture.

Neonatal and adult cardiomyocytes were isolated from rat hearts. Some of the adult myocytes were cultured to allow for cell dedifferentiation, a phenomenon thought to mimic cell changes that occur in stressed myocardium, with myocytes regressing to a fetal pattern of metabolism and stellate neonatal shape.Using fluorescence deconvolution microscopy, cells were probed with fluorescent markers and scanned for a number of proteins associated with ion control, calcium movements and cardiac function. Image analysis of deconvoluted image stacks and sequential real-time image recordings of calcium transients of cells were made.All three myocyte groups were predominantly comprised of binucleate cells. Clustering of proteins to a single nucleus was a common observation, suggesting that one nucleus is active in protein synthesis pathways, while the other nucleus assumes a 'dormant' or different role and that cardiomyocytes might be mitotically active even in late development, or specific protein syntheses could be targeted and regulated for reintroduction into the cell cycle.Such possibilities would extend cardiac disease associated stem cell research and therapy options, while producing valuable insights into developmental and death pathways of binucleate cardiomyocytes (word count 183).

Identification of the signal pathways modulated by expression of p210$\rm\sp{bcr-abl}$ and the inhibition of p210$\rm\sp{bcr-abl}$ transforming activity by polypeptides interacting with p210$\rm\sp{bcr-abl}$ in murine myeloid 32D cells

The Bcr-Abl fusion oncogene which resulted from a balanced reciprocal translocation between chromosome 9 and 22, t(9;22)(q11, q34), encodes a 210 KD elevated tyrosine specific protein kinase that is found in more than 95 percent of chronic myelogenous leukemia patients (CML). Increase of level of phosphorylation of tyrosine is observed on cell cycle regulatory proteins in cells overexpressing the Bcr-Abl oncogene, which activates multiple signaling pathways. In addition, distinct signals are required for transforming susceptible fibroblast and hematopoietic cells, and the minimal signals essential for transforming hematopoietic cells are yet to be defined. In the present study, we first established a tetracycline repressible p210$\rm\sp{bcr-abl}$ expression system in a murine myeloid cell line 32D c13, which depends on IL3 to grow in the presence of tetracycline and proliferate independent of IL3 in the absence of tetracycline. Interestingly, one of these sublines does not form tumors in athymic nude mice suggesting that these cells may not be completely transformed. These cells also exhibit a dose-dependent growth and expression of p210$\rm\sp{bcr-abl}$ at varying concentrations of tetracycline in the culture. However, p210$\rm\sp{bcr-abl}$ rescues IL3 deprivation induced apoptosis in a non-dose dependent fashion. DNA genotoxic damage induced by gamma-irradiation activates c-Abl tyrosine kinase, the cellular homologue of p210$\rm\sp{bcr-abl},$ and leads to activation of p38 MAP kinase in the cells. However, in the presence of p210$\rm\sp{bcr-abl}$ the irradiation failed to activate the p38 MAP kinase as examined by an antibody against phosphorylated p38 MAP kinase. Similarly, an altered tyrosine phosphorylation of the JAK1-STAT1 pathways was identified in cells constitutively overexpressing p210$\rm\sp{bcr-abl}.$ This may provided a molecular mechanism for altered therapeutic response of CML patients to IFN-$\alpha.$^ Bcr-Abl oncoprotein has multiple functional domains which have been identified by the work of others. The Bcr tetramerization domain, which may function to stabilize the association of the Bcr-Abl with actin filaments in p210$\rm\sp{bcr-abl}$ susceptible cells, are essential for transforming both fibroblast and hematopoietic cells. We designed a transcription unit encoding first 160 amino acids polypeptide of Bcr protein to test if this polypeptide can inhibit the transforming activity of the p210$\rm\sp{bcr-abl}$ oncoprotein in the 32D c13 cells. When this vector was transfected transiently along with the p210$\rm\sp{bcr-abl}$ expression vector, it can block the transforming activity of p210$\rm\sp{bcr-abl}.$ On the other hand, the retinoblastoma tumor suppressor protein (Rb), a naturally occurring negative regulator of the c-Abl kinase, the cellular homologue of Bcr-Abl oncoprotein, binds to and inhibits the c-Abl kinase in a cell cycle dependent manner. A polypeptide obtained from the carboxyl terminal end of the retinoblastoma tumor suppressor protein, in which the nuclear localization signal was mutated, was used to inhibit the kinase activity of the p210$\rm\sp{bcr-abl}$ in the cytoplasm. This polypeptide, called Rb MC-box, and its wild type form, Rb C-box, when overexpressed in the 32D cells are mainly localized in the cytoplasm. Cotransfection of a plasmid transcription unit coding for this polypeptide and the gene for the p210$\rm\sp{bcr-abl}$ resulted in reduced plating efficiency of p210$\rm\sp{bcr-abl}$ transfected IL3 independent 32D cells. Together, these results may lead to a molecular approach to therapy of CML and an in vitro assay system to identify new targets to which an inhibitory polypeptide transcription unit may be directed. ^

Characterization of osteopontin charge forms produced by osteoblasts

Osteopontin (OPN) is a highly-phosphorylated extracellular matrix protein localized in bone, kidney, placenta, T-lymphocytes, macrophages, smooth muscle of the vascular system, milk, urine, and plasma. In ROS 17/2.8 osteoblast-like osteosarcoma cells, 1,25-dihydroxyvitamin D3 [1,25(OH)2D 3] regulates OPN at the transcriptional level resulting in increased steady state mRNA levels and increased production of OPN protein, maximal at 48 hours. Using ROS 17/2.8 cells as an osteoblast model, OPN was purified from culture medium after three hour treatments of either vehicle (ethanol) or 1,25(OH)2D3 via barium citrate precipitation followed by immunoaffinity chromatography. ^ Here, further evidence of regulation of OPN by 1,25(OH)2D 3 at the posttranslational level is presented. Prior to the up-regulation of OPN at the transcriptional level, 1,25(OH)2D3 induces a shift in OPN isoelectric point (pI) detected on two-dimensional gels from pI 4.6 to pI 5.1. Loading equal amounts of [32P]-labeled OPN recovered from ROS 17/2.8 cells exposed to 1,25(OH)2D3 or vehicle alone for three hours reveals that the shift from pI 4.6 to 5.1 is the result of reduced phosphorylation. Using structural analogs to 1,25(OH) 2D3, analog AT [25-(OH)-16-ene-23-yne-D3], which triggers Ca2+ influx through voltage sensitive Ca2+ channels but does not bind to the vitamin D receptor, mimicked the OPN pI shift while analog BT [1,25(OH)2-22-ene-24-cyclopropyl-D 3], which binds to the vitamin D receptor but does not allow Ca 2+ influx, did not. Inclusion of the Ca2+ channel blocker nifedipine also blocks the charge shift conversion of OPN. Further analysis of the signaling pathway initiated by 1,25(OH)2D3 reveals that inhibition of the cyclic 3′,5′ -adenosine monophosphate-dependent kinase, protein kinase A, or inhibition of the cyclic 3′,5′-guanine monophosphate-dependent kinase, protein kinase G, also prevents the charge shift conversion. ^ Isolation of OPN from rat femurs and tibiae provides evidence for the existence of these two OPN charge forms in vivo, evidenced by differential migration on isoelectric focusing gels and sodium dodecyl sulfate-polyacrylamide gels. Peptide sequencing of rat long bone fractions revealed the presence of a presumed dentin specific protein, dentin matrix protein-1 (DMP-1). Western blot analysis confirmed the existence of DMP-1 in these fractions. ^ Using the OPN charge forms in functional assays, it was determined that the charge forms have differential roles in both cell surface and mineralization functions. In cell attachment assays and Ca2+ influx assays using PC-3 prostate cancer cells, the pI 5.1 charge form of OPN was found to permit binding and increase intracellular Ca2+ concentrations of PC-3 cells. The increase in intracellular Ca2+ concentration was found to be integrin αvβ3-dependent. In mineralization assays, the pI 4.6 charge form of OPN promoted hydroxyapatite formation, while the pI 5.1 charge form had improved Ca2+ binding ability. ^ In conclusion, these findings suggest that 1,25(OH) 2D3 regulates OPN not only at the transcriptional level, but also plays a role in determination of the OPN phosphorylation state. The latter involves a short term (less than three hours) treatment and is associated with membrane-initiated Ca2+ influx. Functional assays utilizing the two OPN charge forms reveal the dependence of OPN post-translational state on its function. ^

Elucidating the role of mesenchymal stem cell participation in the tumor microenvironment

To meet the requirements for rapid tumor growth, a complex array of non-neoplastic vascular, fibroblastic, and immune cells are recruited to the tumor microenvironment. Understanding the origin, composition, and mechanism(s) for recruitment of these stromal components will help identify areas for therapeutic intervention. Previous findings have suggested that ex-vivo expanded bone marrow-derived MSC home to the sites of tumor development, responding to inflammatory signals and can serve as effective drug delivery vehicles. Therefore, we first sought to fully assess conditions under which MSC migrate to and incorporate into inflammatory microenvironments and the consequences of modulated inflammation. MSC delivered to animals bearing inflammatory insults were monitored by bioluminescence imaging and displayed specific tropism and selective incorporation into all tumor and wound sites. These findings were consistent across routes of tumor establishment, MSC administration, and immunocompetence. MSC were then used as drug delivery vehicles, transporting Interferon β to sites of pancreatic tumors. This therapy was effective at inhibiting pancreatic tumor growth under homeostatic conditions, but inhibition was lost when inflammation was decreased with CDDO-Me combination treatment. Next, to examine the endogenous tumor microenvironment, a series of tissue transplant experiments were carried out in which tissues were genetically labeled and engrafted in recipients prior to tumor establishment. Tumors were then analyzed for markers of tumor associated fibroblasts (TAF): α-smooth muscle actin (α-SMA), nerve glia antigen 2 (NG2), fibroblast activation protein (FAP), and fibroblast specific protein (FSP) as well as endothelial marker CD31 and macrophage marker F4/80. We determined the majority of α-SMA+, NG2+ and CD31+ cells were non-bone marrow derived, while most FAP+, FSP+, and F4/80+ cells were recruited from the bone marrow. In accord, transplants of prospectively isolated BM MSC prior to tumor development indicated that these cells were recruited to the tumor microenvironment and co-expressed FAP and FSP. In contrast, fat transplant experiments revealed recruited fat derived cells co-expressed α-SMA, NG2, and CD31. These results indicate TAF are a heterogeneous population composed of subpopulations with distinct tissues of origin. These models have provided a platform upon which further investigation into tumor microenvironment composition and tests for candidate drugs can be performed. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Transcriptional regulation of the rat {\it mdr1b\/} gene

The expression of P-glycoproteins encoded by the mdr gene family is associated with the emergence of multidrug-resistance phenotype in animal cells. This gene family includes two members, MDR1 and MDR2, in humans, and three members, mdr1a, mdr1b, and mdr2, in rodents. Among them, the rat mdr1b is known to be highly activated during hepatocarcinogenesis, and its expression is sensitive to the treatment with growth factors, cytotoxic drugs, as well as other physical or chemical stresses. It is believed that the transcriptional regulation plays an important role in above events, however little has been known about mechanisms involved.^ To elucidate how mdr1b expression is regulated, we isolated the genomic sequence of the rat mdr1b and functionally dissected its 5$\prime$ promoter region. Our results demonstrated that: (1) the transcription start site of the rat mdr1b is identical to that of the murine mdr1b homologue; (2) a palindromic sequence from bp $-$189 to $-$180 bp is essential for the basal promoter function of the rat mdr1b, and binds to a specific protein that appears to be a novel transcription factor implicated in the regulation of the rat mdr1b expression; (3) a NF-$\kappa$B-binding site from bp $-$167 to $-$159 is also involved in the basal promoter function. The p65/p50 subunits of the NF-$\kappa$B and raf-1 kinase are implicated in the insulin-inducible promoter activity of the mdr1b, suggesting the important role of NF-$\kappa$B in the regulation of the mdr1b by growth factors; (4) a p53-binding site from bp $-$199 to $-$180 is not only essential for the basal promoter activity but also responsible for the induction of mdr1b by cytotoxic agents. In addition, we provided evidence showing that endogenous mdr1b expression can be modulated by wild-type p53. On the basis of these findings, a model of transcriptional regulation of the rat mdr1b was proposed. ^

Prion protein glycosylation is not required for strain-specific neurotropism.

In this study, we tested the hypothesis that the glycosylation of the pathogenic isoform of the prion protein (PrP(Sc)) might encode the selective neurotropism of prion strains. We prepared unglycosylated cellular prion protein (PrP(C)) substrate molecules from normal mouse brain by treatment with PNGase F and used reconstituted serial protein cyclic misfolding amplification reactions to produce RML and 301C mouse prions containing unglycosylated PrP(Sc) molecules. Both RML- and 301C-derived prions containing unglycosylated PrP(Sc) molecules were infectious to wild-type mice, and neuropathological analysis showed that mice inoculated with these samples maintained strain-specific patterns of PrP(Sc) deposition and neuronal vacuolation. These results show that PrP(Sc) glycosylation is not necessary for strain-dependent prion neurotropism.

Studies on the muscle-specific regulatory protein myogenin

Recently, a family of muscle-specific regulatory factors that includes myogenin, myoD, myf-5, and MRF-4 has been identified. They share a high degree of homology within a region that contains a basic and helix-loop-helix domain. Transfection of many non-muscle cell types with any one of these genes results in the activation of the entire myogenic program. To explore the mechanism through which myogenin regulates myogenesis, we have prepared antibodies against peptides specific to myogenin. Using these antibodies we show that myogenin is a 32 Kd phospho-protein which is localized to the nuclei of muscle cells. In vitro, myogenin oligomerizes with the ubiquitous enhancer binding factor E12, and acquires high affinity for an element of the core of the muscle creatine kinase (MCK) enhancer that is conserved among many muscle-specific genes. Myogenin synthesized in BC$\sb3$H1 and C2 muscle cell lines also binds to the same site in the enhancer. However, the MCK enhancer is not activated in 10T1/2 fibroblasts which have been transfected with a constitutive myogenin expression vector until growth factors have been removed from the media. This result indicates that mitogenic signals block the actions of myogenin.. Mutagenesis of the myogenin/E12 binding site in the MCK enhancer abolishes binding of the hetero-oligomer and prevents trans-activation of the enhancer by myogenin. By site directed mutagenesis of myogenin we have shown that the basic region consists of three clusters of basic residues, two of which are required for binding and activation of the myogenic program. Myogenic activation, but not DNA binding, is lost when the 10 residue region between the two required basic clusters is substituted with the corresponding region from E12, which also contains a similar basic and helix-loop-helix domain. Functional revertants of this substitution mutant have identified two amino acids which confer muscle specificity. The properties of myogenin suggest that it functions as a sequence-specific DNA binding factor that interacts directly with muscle-specific genes during myogenesis and contains within its basic domain a region which imparts myogenic activation and is separable from DNA binding. ^

Analysis of pp60$\sp{{\rm c}{-}src}$ and pp62$\sp{{\rm c}{-}yes}$ intracellular protein tyrosine kinase function in colon tumor cell growth regulation using herbimycin A, a tyrosine kinase specific inhibitor

Two approaches were utilized to investigate the role of pp60c-src activation in growth control of model colon tumor cell lines. The first approach involved analysis of pp60c-src activity in response to growth factor treatment to determine if transient activation of the protein was associated with ligand induced mitogenic signal transduction as occurs in non-colonic cell types. Activation of pp60c-src was detected using colon tumor cell lysates after treatment with platelet derived growth factor (PDGF). Activation of pp60c-src was also detected in response to epidermal growth factor (EGF) treatment using cellular lysates and intact cells. In contrast, down-regulation of purified pp60c-src occurred after incubation with EGF-treated EGFr immune complexes in vitro suggesting additional cellular events were potentially required for the stimulatory response observed in intact cells. The results demonstrated activation of pp60c-src in colon tumor cells in response to PDGF and EGF which is consistent with the role of the protein in mitogenic signal transduction in non-colonic cell types.^ The second approach used to study the role of pp60c-src activation in colonic cell growth control focused on analysis of the role of constitutive activation of the protein, which occurs in approximately 80% of colon tumors and cell lines, in growth control. These studies involved analysis of the effects of the tyrosine kinase specific inhibitor Herbimycin A (HA) on monolayer growth and pp60c-src enzymatic activity using model colon tumor cell lines. HA induced dose-dependent growth inhibition of all colon tumor cell lines examined possessing elevated pp60c-src activity. In HT29 cells the dose-dependent growth inhibition induced by HA correlated with dose-dependent pp60c-src inactivation. Inactivation of pp60c-src was shown to be an early event in response to treatment with HA which preceded induction of HT29 colon tumor cell growth inhibition. The growth effects of HA towards the colon tumor cells examined did not appear to be associated with induction of differentiation or a cytotoxic mechanism of action as changes in morphology were not detected in treated cells and growth inhibition (and pp60c-src inactivation) were reversible upon release from treatment with the compound. The results suggested the constitutive activation of pp60c-src functioned as a proliferative signal in colon tumor cells. Correlation between pp60c-src inactivation and growth inhibition was also observed using HA chemical derivatives confirming the role of tyrosine kinase inactivation by these compounds in inhibition of mitogenic signalling. In contrast, in AS15 cells possessing specific antisense mRNA mediated inactivation of pp60c-src, HA-induced inactivation of the related pp62c-yes tyrosine kinase, which is also activated during colon tumor progression, was not associated with induction of monolayer growth inhibition. These results suggested a function for the constitutively activated pp62c-yes protein in colon tumor cell proliferation which was different from that of activated pp60c-src. (Abstract shortened by UMI.) ^

Glioma-specific alternative RNA splicing: A role for polypyrimidine tract binding protein-1

Alternative RNA splicing plays an integral role in cell fate determination and function, especially in the cells of the brain. Errors in RNA processing contribute to diseases such as cancer, where it leads to the production of oncogenic proteins or the loss of tumor suppressors. In silica mining suggests that hundreds of splice isoforms are misexpressed in the glial cell-derived glioma. However, there is little experimental evidence of the prevalence and contribution of these changes and whether they contribute to the formation and progression of this devastating malignancy. To determine the frequency of these aberrant events, global profiling of alternative RNA splice patterns in glioma and nontumor brain was conducted using an exon array. Most splicing changes were less than 5-fold in magnitude and 14 cassette exon events were validated, including 7 previously published events. To determine the possible causes of missplicing, the differential expression levels of splicing factors in these two tissues were also analyzed. Six RNA splicing factors had greater than 2-fold changes in expression. The highest differentially expressed factor was polypyrimidine tract binding protein-1 (PTB). Evaluation by immunohistochemistry determined that this factor was elevated in both early and late stages of glioma. Glial cell-specific PTB expression in the adult brain led me to examine the role of PTB in gliomagenesis. Downregulation of PTB slowed glioma cell proliferation and migration and enhanced cell adhesion to fibronectin and vitronectin. To determine whether PTB was affecting these processes through splicing, genome-wide exon expression levels were correlated with PTB levels. Surprisingly, previously reported PTB target transcripts were insensitive to changes in PTB levels in both patient samples and PTB-depleted glioma cells. Only one validated glioma-specific splice target, RTN4/Nogo, had a significant PTB-mediated splicing change. Downregulation of PTB enhanced inclusion of its alternative exon 3, which encodes an auxiliary domain within a neurite inhibitor protein. Overexpression of this splice isoform in glioma cells slowed proliferation in a manner similar to that observed in PTB knockdown cells. In summary, aberrant expression of splicing factors such as PTB in glioma may elicit changes in splicing patterns that enhance tumorigenesis. ^

Specificity of somatostatin receptor and G -protein interactions as characterized by somatostatin receptor subtype specific antibodies

The neuropeptide somatostatin is a widely distributed general inhibitor of endocrine, exocrine, gastrointestinal and neural functions. The biological actions of somatostatin are initiated by interaction with high affinity, plasma membrane somatostatin receptors (sst receptors). Five sst receptor subtypes have been cloned and sequence analysis shows they are all members of the G protein coupled receptor superfamily. The G proteins play a pivotal role in sst receptor signal transduction and the specificity of somatostatin receptor-G protein coupling defines the possible range of cellular responses. However, the data for endogenous sst receptor and G protein coupling is very limited, and even when it is available, the sst receptor subtypes involved in G protein coupling and signal transduction are unknown due to the expression of multiple sst receptor subtypes in target cell lines or tissues of somatostatin.^ In an effort to characterize each individual sst receptor subtypes, antisera against unique C-terminal regions of different sst receptor subtypes have been developed in our lab. In this report, antisera made against the sst1, sst2A and sst4 receptors are characterized. They are highly specific to their corresponding receptors and efficiently immunoprecipitate the sst receptors. Using these antibodies, the cell lines expressing these sst receptor subtypes were identified with both immunoprecipitation and Western blot methods. The development of sst receptor subtype specific antibodies make it possible to determine the specificity of the sst receptor subtype and G protein coupling in target cells or tissues expressing multiple sst receptors, two questions were addressed by this thesis: (1) whether different cellular environments affect receptor subtype and G protein coupling; (2) whether different sst receptors couple to different G proteins in similar cellular environments.^ Taken together our findings, both sst1 and sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells, G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in GH$\sb4$C$\sb1$ cells. Further, sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in AR4-2J cells while sst4 receptors couple with G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells. Therefore, the G protein coupling of the same sst receptors in different cell lines is basically similar in that they all couple with multiple $\alpha$-subunits of the G$\rm \sb{i}$ proteins, suggesting cellular environment has little effect on receptor and G protein coupling. Moreover, different sst receptors have similar G protein coupling specificities in the same cell line, suggesting components other than receptor and G$\alpha$ subunits in the signal transduction pathways may contribute to specific functions of each sst receptor subtype. This series of experiments represent a novel approach in dissecting signal transduction pathways and may have general application in the field. Furthermore, this is the first systematic study of sst receptor subtype and G protein $\alpha$-subunit interaction in both transfected cells and in normal cell lines. The information generated will be very useful in our understanding of sst receptor signal transduction pathways and in directing future sst receptor research. ^