17 resultados para Regulatory Elements

em DigitalCommons@The Texas Medical Center


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The MUC1 gene encodes a transmembrane mucin glycoprotein that is overexpressed in several cancers of epithelial origin, including those of breast, pancreas, lung, ovary, and colon. Functions of MUC1 include protection of mucosal epithelium, modulation of cellular adhesion, and signal transduction. Aberrantly increased expression of MUC1 in cancer cells promotes tumor progression through adaptation of these functions. Some regulatory elements participating in MUC1 transcription have been described, but the mechanisms responsible for overexpression are largely unknown. A region of MUC1 5′ flanking sequence containing two conserved potential cytokine response elements, an NFκB site at −589/−580 and a STAT binding element (SBE) at −503/−495, has been implicated in high level expression in breast and pancreatic cancer cell lines. Persistent stimulation by proinflammatory cytokines may contribute to increased MUC1 transcription by tumor cells. ^ T47D breast cancer cells and normal human mammary epithelial cells (HMEC) were used to determine the roles of the κB site and SBE in basal and stimulated expression of MUC1. Treatment of T47D cells and HMEC with interferon-γ (IFNγ) alone enhanced MUC1 expression at the level of transcription, and the effect of IFNγ was further stimulated by tumor necrosis factor-α (TNFα). MUC1 responsiveness to these cytokines was modest in T47D cells but clearly evident in HMEC. Transient transfection of T47D cells with mutant MUC1 promoter constructs revealed that the κB site at −589/−580 and the SBE at −503/−495 and were required for cooperative stimulation by TNFα and IFNγ. Electrophoretic mobility shift assays (EMSA) revealed that the synergy was mediated not by cooperative binding of transcription factors but by the independent actions of STAT1α and NFκB p65 on their respective binding sites. Independent mutations in the κB site and SBE abrogated cytokine responsiveness and reduced basal MUC1 promoter activity by 45–50%. However, only the κB site appeared to be constitutively activated in T47D cells, in part by NFκB p65. These findings implicate two cytokine response elements in the 5 ′ flanking region of MUC1, specifically a κB site and a STAT binding element, in overexpression of MUC1 in breast cancer cells. ^

Relevância:

70.00% 70.00%

Publicador:

Resumo:

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The expression of the chicken fast skeletal myosin alkali light chain (MLC) 3f is subject to complex patterns of control by developmental and physiologic signals. Regulation over MLC3f gene expression is thought to be exerted primarily at the transcriptional level. The purpose of this dissertation was to identify cis-acting elements on the 5$\sp\prime$ flanking region of chicken MLC3f gene that are important for transcriptional regulation. The results show that the 5$\sp\prime$ flanking region of MLC3f gene contains multiple cis-acting elements. The nucleotide sequence of these elements demonstrates a high degree of conservation between different species and are also found in the 5$\sp\prime$ flanking regions of many muscle protein genes. The first regulatory region is located between $-$185 and $-$150 bp from the transcription start site and contains an AT-rich element. Linker scanner analyses have revealed that this element has a positive effect on transcription of the MLC3f promoter. Furthermore, when linked to a heterologous viral promoter, it can enhance reporter gene expression in a muscle-specific manner, independent of distance or orientation.^ The second regulatory region is located between $-$96 and $-$64 from the transcription start site. Sequences downstream of $-$96 have the capacity to drive muscle-specific reporter gene expression, although the region between $-$96 and $-$64 has no intrinsic enhancer-like activity. Linker scanner analyses have identified a GC-rich motif that required efficient transcription of the MLC3f promoter. Mutations to this region of DNA results in diminished capacity to drive reporter gene expression and is correlated with disruption of the ability to bind sequence-specific transcription factors. These sequence-specific DNA-binding proteins were detected in both muscle and non-muscle extracts. The results suggest that the mere presence or absence of transcription factors cannot be solely responsible for regulation of MLC3f expression and that tissue-specific expression may arise from complex interactions with muscle-specific, as well as more ubiquitous transcription factors with multiple regulatory elements on the gene. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Histone gene expression is replication-independent during oogenesis and early embryogenesis in amphibians; however, it becomes replication-dependent during later embryogenesis and remains replication-dependent through adulthood. In order to understand the mechanism for this switch in transcriptional regulation of histone gene expression during amphibian development, linker-scanning mutations were made in a Xenopus laevis H2B histone gene promoter by oligonucleotide site-directed mutagenesis and assayed by microinjection into oocytes and embryos. The Xenopus H2B gene has a relatively simple promoter containing several transcriptional regulatory elements, including TFIID, CCAAT, and ATF motifs, required for maximal transcription in both oocytes and embryos. Factors binding to the CCAAT and ATF motifs are present in oocytes and embryos and increase slightly in abundance during early development. A sequence (CTTTACAT) in the frog H2B promoter resembling the conserved octamer motif (ATTTGCAT), the target for cell-cycle regulation of a human H2B gene, is additionally required for maximal H2B transcription in frog embryos. Oocytes and embryos contain multiple octamer-binding proteins that are expressed in a sequential manner during early development. Sequences encoding three novel octamer-binding proteins were isolated from Xenopus cDNA libraries by virtue of their similarity with the DNA binding (POU) domain of the ubiquitously expressed transcription factor Oct-1. The protein encoded by one of these genes, termed Oct-60, was localized mainly in the cytoplasm of oocytes and was also present in early embryos until the gastrula stage of development. Proteins encoded by the other two genes, Oct-25 and Oct-91, were present in embryos after the mid-blastula stage of development and decreased by early neurula stage. The activity of the Xenopus H2B octamer motif in embryos is not specifically associated with increased binding by Oct-1 or the appearance of novel octamer-binding proteins but requires the presence of an intact CCAAT motif. We found that synergistic interactions among promoter elements are important for full H2B promoter activity. The results suggest that transcription of the Xenopus H2B gene is replication-dependent when it is activated at the mid-blastula stage of development and that replication-dependent H2B transcription is mediated by Oct-1. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Genetic analysis is a powerful method for analyzing the function of specific genes in development. I sought to identify novel genes in the mouse using a genetic analysis relying on the expression pattern and phenotype of mutated genes. To this end, I have conducted a gene trap screen using the vector $\rm SA\beta geo,$ a promoterless DNA construct that encodes a fusion protein with lacZ and neomycin resistance activities. Productive integration and expression of the $\beta$geo protein in embryonic stem (ES) cells requires integration into an active transcription unit. The endogenous regulatory elements direct reporter gene expression which reflects the expression of the endogenous gene. Of eight mouse lines generated from gene trap ES cell clones, four showed differential regulation of $\beta$geo activity during embryogenesis. These four were analyzed in more detail.^ Three of the lines RNA 1, RNA2 and RNA 3 had similar expression patterns, within subsets of cells in sites of embryonic hematopoiesis. Cloning of the trapped genes revealed that all three integrations had occurred within 45S rRNA precursor transcription units. These results imply that there exists in these cells some mechanism responsible for the efficient production of the $\beta$geo protein from an RNA polymerase I transcript that is not present in most of the cells in the embryo.^ The fourth line, GT-2, showed widespread, dynamic expression. Many of the sites of expression were important classic embryonic induction systems. Cloning of the sequences fused to the $5\sp\prime$ end of the $\beta$geo sequence revealed that the trapped gene contained significant sequence homology with a previously identified human sequence HumORF5. An open reading frame of this sequence is homologous to a group of eukaryotic proteins that are members of the RNA helicase superfamily I.^ Analysis of the gene trap lines suggests that potentially novel developmental mechanisms have been uncovered. In the case of RNA 1, 2 and 3, the differential production of ribosomal RNAs may be required for differentiation or function of the $\beta$geo positive hematopoietic cells. In the GT-2 line, a previously unsuspected temporal and spatial regulation of a putative RNA helicase implies a role for this activity during specific aspects of mouse development. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The Wilms' tumor 1 gene (WT1) encodes a zinc-finger transcription factor and is expressed in urogenital, hematopoietic and other tissues. It is expressed in a temporal and spatial manner in both embryonic and adult stages. To obtain a better understanding of the biological function of WT1, we studied two aspects of WT1 regulation: one is the identification of tissue-specific cis-regulatory elements that regulate its expression, the other is the downstream genes which are modulated by WT1.^ My studies indicate that in addition to the promoter, other regulatory elements are required for the tissue specific expression of this gene. A 259-bp hematopoietic specific enhancer in intron 3 of the WT1 gene increased the transcriptional activity of the WT1 promoter by 8- to 10-fold in K562 and HL60 cells. Sequence analysis revealed both GATA and c-Myb motifs in the enhancer fragment. Mutation of the GATA motif decreased the enhancer activity by 60% in K562 cells. Electrophoretic mobility shift assays showed that both GATA-1 and GATA-2 proteins in K562 nuclear extracts bind to this motif. Cotransfection of the enhancer containing reporter construct with a GATA-1 or GATA-2 expression vector showed that both GATA-1 and GATA-2 transactivated this enhancer, increasing the CAT reporter activity 10-15 fold and 5-fold respectively. Similar analysis of the c-Myb motif by cotransfection with the enhancer CAT reporter construct and a c-Myb expression vector showed that c-Myb transactivated the enhancer by 5-fold. A DNase I-hypersensitive site has been identified in the 258 bp enhancer region. These data suggest that GATA-1 and c-Myb are responsible for the activity of this enhancer in hematopoietic cells and may bind to the enhancer in vivo. In the process of searching for cis-regulatory elements in transgenic mice, we have identified a 1.0 kb fragment that is 50 kb downstream from the promoter and is required for the central nervous system expression of WT1.^ In the search for downstream target genes of WT1, we noted that the proto-oncogene N-myc is coexpressed with the tumor suppressor gene WT1 in the developing kidney and is overexpressed in many Wilms' tumors. Sequence analysis revealed eleven consensus WT1 binding sites located in the 1 kb mouse N-myc promoter. We further showed that the N-myc promoter was down-regulated by WT1 in transient transfection assays. Electrophoretic mobility shift assays showed that oligonucleotides containing the WT1 motifs could bind WT1 protein. Furthermore, a Denys-Drash syndrome mutant of WT1, R394W, that has a mutation in the DNA binding domain, failed to repress the N-myc promoter. This suggests that the repression of the N-myc promoter is mediated by DNA binding of WT1. This finding helps to elucidate the relationship of WT1 and N-myc in tumorigenesis and renal development. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

This dissertation describes the identification and characterization of human dermatan sulfate proteoglycan 3 (DSPG3) and the characterization of the transcriptional regulation of human cartilage oligomeric matrix protein (COMP) in cartilage, ligament, and tendon cells. DSPG3 and COMP are two extracellular matrix proteins. The function of these ECM proteins is unknown.^ DSPG3 was cloned, sequenced, and shown to be expressed in cartilage, ligament, and placenta. DSPG3 was mapped to human chromosome 12q21, and the genomic structure was identified. 1.6 kb of the promoter region has been sequenced, and several putative SOX9 sites were identified as well as 3 TATA sites. Furthermore, an evolutionary tree of the SLRP gene family, which includes DSPG3, is presented.^ The promoter region of COMP was cloned and sequenced. Several putative transcription factor binding sites were identified including multiple AP2 and SP1 sites. Three transcription start sites were found to be located directly downstream of one of the SP1 sites. In addition, the expression of COMP was demonstrated to be higher in tendon than in cartilage and ligament by both Northern and Western blot analysis, and several regions of the COMP promoter were shown to contain cell-specific regulatory elements. Analysis of the proximal 370bp region of the COMP promoter has also identified distinct patterns of nuclear protein binding for the three tissues, and two SP1 sites may play a role in the tissue-specific expression of COMP. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Although bone morphogenetic proteins (BMPs) were initially identified for their potent bone-inducing activity, their precise roles in processes of endochondral and intramembranous bone formation are far from being clear. Tissue-specific loss-of-function experiments using the BMP receptor type IA (BMPR-IA) are particularly attractive since this receptor is thought to be essential for signaling by the closely related BMPs -2, 4, and 7. To ablate signaling through this receptor during chondrogenesis, we have generated transgenic mice expressing Cre recombinase under the control of the collagen type II (Col2a1) gene regulatory sequences. Mice lacking BMPR-IA function in chondrocytes display a number of skeletal abnormalities, including defects in bones of the chondrocranium, abnormal dorsal vertebral processes, scapulae with severe hypoplasia of dorsal elements, and shortening of the long bones. Alterations in the growth plate of long bones in mutants suggest that BMPR-IA is not required for early steps of the chondrocyte specification, but is rather important in regulation of terminal differentiation. Molecular analysis revealed noticeable downregulation of the Ihh/Ptch signalling pathway, decreased chondrocyte proliferation rate and deregulation of hypertrophy. ^ In order to elucidate the role of BMP signalling in development of the limb and intramembranous ossification, we have used mice expressing Cre recombinase under control of the Prx1 (MHox) regulatory elements (M. Logan, pers comm.). Cre activity was found in those mice in the developing limb bud mesenchyme, as well as in a subset of cranial neural crest cells. Prx1-Cre-induced conditional mutants display prominent defects in distal limb outgrowth, as well as ossification defects in a number of neural crest-derived calvarial bones. Intriguingly, mutant limbs displayed alterations in patterning along all three axes. Molecular analysis revealed ectopic anterior Shh/Ptch signalling pathway activation and expression of some Hox genes. Observed loss of Msx1 and Msx2 expression in the progress zone correlates with downregulation of Cyclin D1 and decreased distal outgrowth. Abnormal ventral localization of Lmx1b-expressing cells along with observed later morphological abnormalities suggest a novel role for BMP signalling in establishment or maintaining of the dorso-ventral polarity in the limb mesoderm. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^