The Hospital Study of the City of Houston and Harris County

In 1941 the Texas Legislature appropriated $500,000 to the Board of Regents of the University of Texas to establish a cancer research hospital. The M. D. Anderson Foundation offered to match the appropriation with a grant of an equal sum and to provide a permanent site in Houston. In August, 1942 the Board of Regent of the University and the Trustees of the Foundation signed an agreement to embark on this project. This institution was to be the first one in the medical center, which was incorporated in October, 1945. The Board of Trustees of the Texas Medical Center commissioned a hospital survey to: - Define the needed hospital facilities in the area - Outline an integrated program to meet these needs - Define the facilities to be constructed - Prepare general recommendations for efficient progress The Hospital Study included information about population, hospitals, and other health care and education facilities in Houston and Harris County at that time. It included projected health care needs for future populations, education needs, and facility needs. It also included detailed information on needs for chronic illnesses, a school of public health, and nursing education. This study provides valuable information about the general population and the state of medicine in Houston and Harris County in the 1940s. It gives a unique perspective on the anticipated future as civic leaders looked forward in building the city and region. This document is critical to an understanding of the Texas Medical Center, Houston and medicine as they are today. SECTIONS INCLUDE: Abstract The Abstract was a summary of the 400 page document including general information about the survey area, community medical assets, and current and projected medical needs which the Texas Medical Center should meet. The 123 recommendations were both general (e.g., 12. “That in future planning, the present auxiliary department of the larger hospitals be considered inadequate to carry an added teaching research program of any sizable scope.”) and specific (e.g., 22. That 14.3% of the total acute bed requirement be allotted for obstetric care, reflecting a bed requirement of 522 by 1950, increasing to 1,173 by 1970.”) Section I: Survey Area This section basically addressed the first objective of the survey: “define the needed hospital facilities in the area.” Based on the admission statistics of hospitals, Harris County was included in the survey, with the recognition that growth from out-lying regional areas could occur. Population characteristics and vital statistics were included, with future trends discussed. Each of the hospitals in the area and government and private health organizations, such as the City-County Welfare Board, were documented. Statistics on the facilities use and capacity were given. Eighteen recommendations and observations on the survey area were given. Section II: Community Program This section basically addressed the second objective of the survey: “outline an integrated program to meet these needs.” The information from the Survey Area section formed the basis of the plans for development of the Texas Medical Center. In this section, specific needs, such as what medical specialties were needed, the location and general organization of a medical center, and the academic aspects were outlined. Seventy-four recommendations for these plans were provided. Section III: The Texas Medical Center The third and fourth objectives are addressed. The specific facilities were listed and recommendations were made. Section IV: Special Studies: Chronic Illness The five leading causes of death (heart disease, cancer, “apoplexy”, nephritis, and tuberculosis) were identified and statistics for morbidity and mortality provided. Diagnostic, prevention and care needs were discussed. Recommendations on facilities and other solutions were made. Section IV: Special Studies: School of Public Health An overview of the state of schools of public health in the US was provided. Information on the direction and need of this special school was also provided. Recommendations on development and organization of the proposed school were made. Section IV: Special Studies: Needs and Education Facilities for Nurses Nursing education was connected with hospitals, but the changes to academic nursing programs were discussed. The needs for well-trained nurses in an expanded medical environment were anticipated to result in significant increased demands of these professionals. An overview of the current situation in the survey area and recommendations were provided. Appendix A Maps, tables and charts provide background and statistical information for the previous sections. Appendix B Detailed census data for specific areas of the survey area in the report were included. Sketches of each of the fifteen hospitals and five other health institutions showed historical information, accreditations, staff, available facilities (beds, x-ray, etc.), academic capabilities and financial information.

Analysis of mutations in $\beta$-tubulin genes affecting tubulin stability and assembly

Cmd4 is a colcemid-sensitive CHO cell line that is temperature sensitive for growth and expresses an altered $\beta$-tubulin, $\beta\sb1$. One revertant of this cell line, D2, exhibits a further alteration in $\beta\sb1$ resulting in an acidic shift in its isoelectric point and a decrease in its molecular weight to 40 kD, as measured by two dimensional gel electrophoresis. This $\beta$-tubulin variant has been shown to be assembly-defective and unstable. Characterization of the mutant $\beta\sb1$ in D2 by high pressure liquid chromatography (HPLC) revealed the loss of methionine containing tryptic peptides 7,8,9, and 10. Southern analysis of the genomic DNA digested with several different restriction enzymes resulted in the appearance of new restriction fragments 250 base pairs shorter than the corresponding fragments from the wild-type $\beta\sb1$-tubulin gene. Northern analysis on mRNA from D2 revealed two new message products that also differed by 250 bases from the corresponding wild type $\beta$-tubulin transcripts. To precisely define the region of the alteration, cloning and sequencing of the mutant and wild type genomic $\beta$-tubulin genes were conducted. A size-selected EcoRI genomic library was prepared using the Stratagene lambda Zap II phage cloning system. Using subclones of CHO $\beta$-tubulin cDNA as probes, a 2.5 kb wild type clone and a 2.3 kb mutant clone were identified from this library. Each of these was shown to contain a portion of the gene extending from intron 3 through the end of the coding sequence in exon 4 and into the 3$\sp\prime$ untranslated region on the basis of alignment with the published human $\beta$-tubulin sequence. Sequencing of the mutant 2.3 kb clone revealed that the mutation is due to a 246 base pair internal deletion in exon 4 (base pair 756-1001) that encodes amino acids 253-334. This deletion results in the loss of a putative binding site for GTP which could potentially explain the phenotype of this mutant $\beta$-tubulin. Also sequence comparison of the 3$\sp\prime$ untranslated region between different species revealed the conservation of 200 base pairs with 78% homology. It is proposed that this region could play an important role in the regulation of $\beta$-tubulin gene expression. ^

Identification and characterization of distinct classes of cAMP-pulse-induced genes in Dictyostelium discoideum development

The unicellular amoeba Dictyostelium discoideum embarks on a developmental program upon starvation. During development, extracellular oscillatory cAMP signaling orchestrates the chemotaxis-mediated aggregation of ∼105 amoebae and is required for optimal induction of so-called pulse-induced genes. This requirement for pulsatile CAMP reflects adaptation of the cAMP-receptor-mediated pathways that regulate these genes. Through examination of a collection of pulse-induced genes, we defined two distinct gene classes based on their induction kinetics and the impact of mutations that impair PKA signaling. The first class (represented by D2 and prtA) is highly dependent on PKA signaling, whereas the second class (represented by carA, gpaB, and acaA) is not. Analysis of expression kinetics revealed that these classes are sequentially expressed with the PKA-independent genes peaking in expression before the PKA-dependent class. Experiments with cycloheximide, an inhibitor of translation, demonstrated that the pulse induction of both classes depends on new protein synthesis early in development. carA and gpaB also exhibit pulse-independent, starvation-induced expression which, unlike their pulse induction, was found to be insensitive to cycloheximide added at the outset of starvation. This result indicates that the mechanism of starvation induction pre-exists in growing cells and is distinct from the pulse induction mechanism for these genes. In order to identify cis-acting elements that are critical for induction of carA, we constructed a GFP reporter controlled by a 914-base-pair portion of its promoter and verified that its expression was PKA-independent, pulse-inducible, and developmentally regulated like the endogenous carA gene. By a combination of truncation, internal deletion, and site-directed mutation, we defined several distinct functional elements within the carA promoter, including a 39-bp region required for pulse induction between base pairs -321 and -282 (relative to the transcription start site), a 131-bp region proximal to the start site that is sufficient for starvation induction, and two separate enhancer domains. Identification of factors that interact with these promoter elements and genetic approaches exploiting the GFP reporter described here should help complete our understanding of the mechanisms regulating these genes, including adaptation mechanisms that likely also govern chemotaxis of Dictyostelium and mammalian cells. ^

Prognostic significance of xCT polymorphisms and expression in patients with advanced pancreatic cancer treated with chemotherapy

The plasma membrane xc- cystine/glutamate transporter mediates cellular uptake of cystine in exchange for intracellular glutamate and is highly expressed by pancreatic cancer cells. The xCT gene, encoding the cystine-specific xCT protein subunit of xc-, is important in regulating intracellular glutathione (GSH) levels, critical for cancer cell protection against oxidative stress, tumor growth and resistance to chemotherapeutic agents including platinum. We examined 4 single nucleotide polymorphisms (SNPs) of the xCT gene in 269 advanced pancreatic cancer patients who received first line gemcitabine with or without cisplatin or oxaliplatin. Genotyping was performed using Taqman real-time PCR assays. A statistically significant correlation was noted between the 3' untranslated region (UTR) xCT SNP rs7674870 and overall survival (OS): Median survival time (MST) was 10.9 and 13.6 months, respectively, for the TT and TC/CC genotypes (p = 0.027). Stratified analysis showed the genotype effect was significant in patients receiving gemcitabine in combination with platinum therapy (n = 145): MST was 10.5 versus 14.1 months for the TT and TC/CC genotypes, respectively (p = 0.013). The 3' UTR xCT SNP rs7674870 may correlate with OS in pancreatic cancer patients receiving gemcitabine and platinum combination therapy. Paraffin-embedded core and surgical biopsy tumor specimens from 98 patients with metastatic pancreatic adenocarcinoma were analyzed by immunohistochemistry using an xCT specific antibody. xCT protein IHC expression scores were analyzed in relation to overall survival in 86 patients and genotype in 12 patients and no statistically significant association was found between the level of xCT IHC expression score and overall survival (p = 0.514). When xCT expression was analyzed in terms of treatment response, no statistically significant associations could be determined (p = 0.908). These data suggest that polymorphic variants of xCT may have predictive value, and that the xc- transporter may represent an important target for therapy in pancreatic cancer.

Structure-function analyses of {\it PAX6\/} and the molecular bases of aniridia

PAX6 is a transcription activator that regulates eye development in animals ranging from Drosophila to human. The C-terminal region of PAX6 is proline/serine/threonine-rich (PST) and functions as a potent transactivation domain when attached to a heterologous DNA-binding domain of the yeast transcription factor, GAL4. The PST region comprises 152 amino acids encoded by four exons. The transactivation function of the PST region has not been defined and characterized in detail by in vitro mutagenesis. I dissected the PST domain in two independent systems, a heterologous system using a GAL4 DNA-binding site and the native system of PAX6. In both systems, the results show consistently that all four constituent exons of the PST domain are responsible for the transactivation function. The four exon fragments act cooperatively to stimulate transcription, although none of them can function individually as an independent transactivation domain. Combinations of two or more exon fragments can reconstitute substantial transactivation activity when fused to the DNA-binding domain of GAL4, but they surprisingly do not produce much activity in the context of native PAX6 even though the mutant PAX6 proteins are stable and their DNA-binding function remains unaffected. I conclude that the PAX6 protein contains an unusually large transactivation domain that is evolutionarily conserved to a high degree, and that its full transactivation activity relies on the cooperative action of the four exon fragments.^ Most PAX6 mutations detected in patients with aniridia result in truncations of the protein. Some of the truncation mutations occur in the PST region of PAX6, resulting in mutant proteins that retain their DNA-binding ability but have no significant transactivation activity. It is not clear whether such mutants are true loss-of-function or dominant-negative mutants. I show that these mutants are dominant-negative if they are coexpressed with wild-type PAX6 in cultured cells and that the dominant-negative effects result from enhanced DNA-binding ability of these mutants due to removal of the PST domain. These mutants are able to repress the wild-type PAX6 activity not only at target genes with paired domain binding sites but also at target genes with homeodomain binding sites.^ Mutations in the human PAX6 gene produce various phenotypes, including aniridia, Peters' anomaly, autosomal dominant keratitis, and familial foveal dysplasia. The various phenotypes may arise from different mutations in the same gene. To test this theory, I performed a functional analysis of two missense mutations in the paired domain: the R26G mutation reported in a case of Peters' anomaly, and the I87R mutation identified in a patient with aniridia. While both the R26 and the I87 positions are conserved in the paired boxes of all known PAX genes, X-ray crystallography has shown that only R26 makes contact with DNA. I found that the R26G mutant failed to bind a subset of paired domain binding sites but, surprisingly, bound other sites and successfully transactivated promoters containing those sites. In contrast, the I87R mutant had lost the ability to bind DNA at all tested sites and failed to transactivate promoters. My data support the haploinsufficiency hypothesis of aniridia, and the hypothesis that R26G is a hypomorphic allele. ^

Characterization of dermatan sulfate proteoglycan 3 (DSPG3) and cartilage oligomeric matrix protein (COMP)

This dissertation describes the identification and characterization of human dermatan sulfate proteoglycan 3 (DSPG3) and the characterization of the transcriptional regulation of human cartilage oligomeric matrix protein (COMP) in cartilage, ligament, and tendon cells. DSPG3 and COMP are two extracellular matrix proteins. The function of these ECM proteins is unknown.^ DSPG3 was cloned, sequenced, and shown to be expressed in cartilage, ligament, and placenta. DSPG3 was mapped to human chromosome 12q21, and the genomic structure was identified. 1.6 kb of the promoter region has been sequenced, and several putative SOX9 sites were identified as well as 3 TATA sites. Furthermore, an evolutionary tree of the SLRP gene family, which includes DSPG3, is presented.^ The promoter region of COMP was cloned and sequenced. Several putative transcription factor binding sites were identified including multiple AP2 and SP1 sites. Three transcription start sites were found to be located directly downstream of one of the SP1 sites. In addition, the expression of COMP was demonstrated to be higher in tendon than in cartilage and ligament by both Northern and Western blot analysis, and several regions of the COMP promoter were shown to contain cell-specific regulatory elements. Analysis of the proximal 370bp region of the COMP promoter has also identified distinct patterns of nuclear protein binding for the three tissues, and two SP1 sites may play a role in the tissue-specific expression of COMP. ^

POU domain transcription factor Brn3b is critical for the normal development and survival of retinal ganglion cells

The POU domain transcription factor Brn3b/POU4F2 plays a critical role regulating gene expression in mouse retinal ganglion cells (RGCs). Previous investigations have shown that Brn3b is not required for initial cell fate specification or migration; however, it is essential for normal RGC differentiation. In contrast to wild type axons, the mutant neurites were phenotypically different: shorter, rougher, disorganized, and poorly fasciculated. Wild type axons stained intensely with axon specific marker tau-1, while mutant projections were weakly stained and the mutant projections showed strong labeling with dendrite specific marker MAP2. Brn-3b mutant axonal projections contained more microtubules and fewer neurofilaments, a dendritic characteristic, than the wild type. The mutant neurites also exhibited significantly weaker staining of neurofilament low-molecular-weight (NF-L) in the axon when compared to the wild type, and NF-L accumulation in the neuron cell body. The absence of Brn-3b results in an inability to form normal axons and enhanced apoptosis in RGCs, suggesting that Brn-3b may control a set of genes involved in axon formation. ^ Brn3b contains several distinct sequence motifs: a glycine/serine rich region, two histidine rich regions, and a fifteen amino acid conserved sequence shared by all Brn3 family members in the N-terminus and a POU specific and POU homeodomain in the C-terminus. Brn3b activates a Luciferase reporter over 25 fold in cell culture when binding to native brn3 binding sites upstream of a minimal promoter. When fused to the Gal4 DNA Binding domain (DBD) and driven by either a strong (CMV) or weaker (pAHD) promoter, the N-terminal of Brn3b is capable of similar activation when binding to Gal4 UAS sites, indicating a presumptive activator of transcription. Both full length Brn3b or the C-terminus fused to the Gal4DBD and driven by pCMV repressed a Luciferase reporter downstream of UAS binding sites. Lower levels of expression of the fusion protein driven by pADH resulted in an alleviation of repression. This repression appears to be a limitation of this system of transcriptional analysis and a potential pitfall in conventional pCMV based transfection assays. ^

Trauma care capacity and performance in Texas: Regional comparisons

Objective. The study reviewed one year of Texas hospital discharge data and Trauma Registry data for the 22 trauma services regions in Texas to identify regional variations in capacity, process of care and clinical outcomes for trauma patients, and analyze the statistical associations among capacity, process of care, and outcomes. ^ Methods. Cross sectional study design covering one year of state-wide Texas data. Indicators of trauma capacity, trauma care processes, and clinical outcomes were defined and data were collected on each indicator. Descriptive analyses were conducted of regional variations in trauma capacity, process of care, and clinical outcomes at all trauma centers, at Level I and II trauma centers and at Level III and IV trauma centers. Multilevel regression models were performed to test the relations among trauma capacity, process of care, and outcome measures at all trauma centers, at Level I and II trauma centers and at Level III and IV trauma centers while controlling for confounders such as age, gender, race/ethnicity, injury severity, level of trauma centers and urbanization. ^ Results. Significant regional variation was found among the 22 trauma services regions across Texas in trauma capacity, process of care, and clinical outcomes. The regional trauma bed rate, the average staffed bed per 100,000 varied significantly by trauma service region. Pre-hospital trauma care processes were significantly variable by region---EMS time, transfer time, and triage. Clinical outcomes including mortality, hospital and intensive care unit length of stay, and hospital charges also varied significantly by region. In multilevel regression analysis, the average trauma bed rate was significantly related to trauma care processes including ambulance delivery time, transfer time, and triage after controlling for age, gender, race/ethnicity, injury severity, level of trauma centers, and urbanization at all trauma centers. Transfer time only among processes of care was significant with the average trauma bed rate by region at Level III and IV. Also trauma mortality only among outcomes measures was significantly associated with the average trauma bed rate by region at all trauma centers. Hospital charges only among outcomes measures were statistically related to trauma bed rate at Level I and II trauma centers. The effect of confounders on processes and outcomes such as age, gender, race/ethnicity, injury severity, and urbanization was found significantly variable by level of trauma centers. ^ Conclusions. Regional variation in trauma capacity, process, and outcomes in Texas was extensive. Trauma capacity, age, gender, race/ethnicity, injury severity, level of trauma centers and urbanization were significantly associated with trauma process and clinical outcomes depending on level of trauma centers. ^ Key words: regionalized trauma systems, trauma capacity, pre-hospital trauma care, process, trauma outcomes, trauma performance, evaluation measures, regional variations ^

Emergency health care assessment in the Houston-Galveston region 2002--2006

Background. Previous studies show emergency rooms to be over crowded nation wide. With growing attention to this problem, the Houston-Galveston Area Council (H-GAC) initiated a study in 2005 to assess their region's emergency health care system, and continued this effort in 2007. The purpose of this study was to examine recent changes in volume, capacity and performance in the Houston-Galveston region's emergency health care system and determine whether the system has been able to effectively respond to the residents' demands. Methods. Data were collected by the Houston-Galveston Area Council and The Abaris Group using a self-administered 2002-2006 survey completed by administrators of the region's hospitals, EMS providers, and select fire departments that provide EMS services. Data from both studies were combined and matched to examine trends. Results. Volume increased among the reporting hospitals within the Houston-Galveston region from 2002 to 2006; however, capacity remained relatively unchanged. EMS providers reported higher average off load times in 2007 compared to 2005, but the increases were not statistically significant. Hospitals reported transferring a statistically significant greater percentage of patients in 2006 than 2004. There was no statistically significant change in any of the other measures. Conclusion. These findings indicate an increase in demand for the Houston-Galveston region's emergency healthcare services with no change in supply. Additional studies within the area are needed to fully assess and evaluate the impact of these changes on system performance. ^

Bioterrorism preparedness at a hospital level in the Southwest Region of the United States -- A systematic review

Since the tragic events of September, 11 2001 the United States bioterrorism and disaster preparedness has made significant progress; yet, numerous research studies of nationwide hospital emergency response have found alarming shortcomings in surge capacity and training level of health care personnel in responding to bioterrorism incidents. The primary goals of this research were to assess hospital preparedness towards the threat of bioterrorist agents in the Southwest Region of the United States and provide recommendations for its improvement. Since little formal research has been published on the hospital preparedness of Oklahoma, Arizona, Texas and New Mexico, this research study specifically focused on the measurable factors affecting the respective states' resources and level of preparedness, such as funding, surge capacity and preparedness certification status.^ Over 300 citations of peer-reviewed articles and 17 Web sites were reviewed, of which 57 reports met inclusion criteria. The results of the systematic review highlighted key gaps in the existing literature and the key targets for future research, as well as identified strengths and weaknesses of the hospital preparedness in the Southwest states compared to the national average. ^ Based on the conducted research, currently, the Southwest states hospital systems are unable fully meet presidential preparedness mandates for emergency and disaster care: the staffed beds to 1,000 population value fluctuated around 1,5 across the states; funding for the hospital preparedness lags behind hospital costs by millions of dollars; and public health-hospital partnership in bioterrorism preparedness is quite weak as evident in lack of joint exercises and training. However, significant steps towards it are being made, including on-going hospital preparedness certification by the Joint Commission of Health Organization. Variations in preparedness levels among states signify that geographic location might determine a hospital level of bioterrorism preparedness as well, tending to favor bigger states such as Texas.^ Suggested recommendations on improvement of the hospital bioterrorism preparedness are consistent with the existing literature and include establishment and maintenance of solid partnerships between hospitals and public health agencies, conduction of joint exercises and drills for the health care personnel and key partners, improved state and federal funding specific to bioterrorism preparedness objectives, as well as on-going training of the clinical personnel on recognition of the bioterrorism agents.^

An examination of the cross-cultural reliability and construct validity of a measure of loneliness

Loneliness is a pervasive, rather common experience in American culture, particularly notable among adolescents. However, the phenomenon is not well documented in the cross-cultural psychiatric literature. For psychiatric epidemiology to encompass a wide array of psychopathologic phenomena, it is important to develop useful measures to characterize and classify both non-clinical and clinical dysfunction in diverse subgroups and cultures.^ The goal of this research was to examine the cross-cultural reliability and construct validity of a scale designed to measure loneliness. The Roberts Loneliness Scale (RLS-8) was administered to 4,060 adolescents ages 10-19 years enrolled in high schools along either side of the Texas-Tamaulipas border region between the U.S. and Mexico. Data collected in 1988 from a study focusing on substance use and psychological distress among adolescents in these regions were used to examine the operating characteristics of the RLS-8. A sample stratified by nationality and language, age, gender, and grade was used for analysis.^ Results indicated that in general the RLS-8 has moderate reliability in the U.S. sample, but not in the Mexican sample. Validity analyses demonstrated that there was evidence for convergent validity of the RLS-8 in the U.S. sample, but none in the Mexican sample. Discriminant validity of the measures in neither sample could be established. Based on the factor structure of the RLS-8, two subscales were created and analyzed for construct validity. Evidence for convergent validity was established for both subscales in both national samples. However, the discriminant validity of the measure remains unsubstantiated in both national samples. Also, the dimensionality of the scale is unresolved.^ One primary goal for future cross-cultural research would be to develop and test better defined culture-specific models of loneliness within the two cultures. From such scientific endeavor, measures of loneliness can be developed or reconstructed to classify the phenomenon in the same manner across cultures. Since estimates of prevalence and incidence are contingent upon reliable and valid screening or diagnostic measures, this objective would serve as an important foundation for future psychiatric epidemiologic inquiry into loneliness. ^

NOVEL PHANTOMS AND POST-PROCESSING FOR DIFFUSION SPECTRUM IMAGING

High Angular Resolution Diffusion Imaging (HARDI) techniques, including Diffusion Spectrum Imaging (DSI), have been proposed to resolve crossing and other complex fiber architecture in the human brain white matter. In these methods, directional information of diffusion is inferred from the peaks in the orientation distribution function (ODF). Extensive studies using histology on macaque brain, cat cerebellum, rat hippocampus and optic tracts, and bovine tongue are qualitatively in agreement with the DSI-derived ODFs and tractography. However, there are only two studies in the literature which validated the DSI results using physical phantoms and both these studies were not performed on a clinical MRI scanner. Also, the limited studies which optimized DSI in a clinical setting, did not involve a comparison against physical phantoms. Finally, there is lack of consensus on the necessary pre- and post-processing steps in DSI; and ground truth diffusion fiber phantoms are not yet standardized. Therefore, the aims of this dissertation were to design and construct novel diffusion phantoms, employ post-processing techniques in order to systematically validate and optimize (DSI)-derived fiber ODFs in the crossing regions on a clinical 3T MR scanner, and develop user-friendly software for DSI data reconstruction and analysis. Phantoms with a fixed crossing fiber configuration of two crossing fibers at 90° and 45° respectively along with a phantom with three crossing fibers at 60°, using novel hollow plastic capillaries and novel placeholders, were constructed. T2-weighted MRI results on these phantoms demonstrated high SNR, homogeneous signal, and absence of air bubbles. Also, a technique to deconvolve the response function of an individual peak from the overall ODF was implemented, in addition to other DSI post-processing steps. This technique greatly improved the angular resolution of the otherwise unresolvable peaks in a crossing fiber ODF. The effects of DSI acquisition parameters and SNR on the resultant angular accuracy of DSI on the clinical scanner were studied and quantified using the developed phantoms. With a high angular direction sampling and reasonable levels of SNR, quantification of a crossing region in the 90°, 45° and 60° phantoms resulted in a successful detection of angular information with mean ± SD of 86.93°±2.65°, 44.61°±1.6° and 60.03°±2.21° respectively, while simultaneously enhancing the ODFs in regions containing single fibers. For the applicability of these validated methodologies in DSI, improvement in ODFs and fiber tracking from known crossing fiber regions in normal human subjects were demonstrated; and an in-house software package in MATLAB which streamlines the data reconstruction and post-processing for DSI, with easy to use graphical user interface was developed. In conclusion, the phantoms developed in this dissertation offer a means of providing ground truth for validation of reconstruction and tractography algorithms of various diffusion models (including DSI). Also, the deconvolution methodology (when applied as an additional DSI post-processing step) significantly improved the angular accuracy of the ODFs obtained from DSI, and should be applicable to ODFs obtained from the other high angular resolution diffusion imaging techniques.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^