17 resultados para NEGATIVE MAGNETORESISTANCE
em DigitalCommons@The Texas Medical Center
Resumo:
cAMP-response element binding (CREB) proteins are involved in transcriptional regulation in a number of cellular processes (e.g., neural plasticity and circadian rhythms). The CREB family contains activators and repressors that may interact through positive and negative feedback loops. These loops can be generated by auto- and cross-regulation of expression of CREB proteins, via CRE elements in or near their genes. Experiments suggest that such feedback loops may operate in several systems (e.g., Aplysia and rat). To understand the functional implications of such feedback loops, which are interlocked via cross-regulation of transcription, a minimal model with a positive and negative loop was developed and investigated using bifurcation analysis. Bifurcation analysis revealed diverse nonlinear dynamics (e.g., bistability and oscillations). The stability of steady states or oscillations could be changed by time delays in the synthesis of the activator (CREB1) or the repressor (CREB2). Investigation of stochastic fluctuations due to small numbers of molecules of CREB1 and CREB2 revealed a bimodal distribution of CREB molecules in the bistability region. The robustness of the stable HIGH and LOW states of CREB expression to stochastic noise differs, and a critical number of molecules was required to sustain the HIGH state for days or longer. Increasing positive feedback or decreasing negative feedback also increased the lifetime of the HIGH state, and persistence of this state may correlate with long-term memory formation. A critical number of molecules was also required to sustain robust oscillations of CREB expression. If a steady state was near a deterministic Hopf bifurcation point, stochastic resonance could induce oscillations. This comparative analysis of deterministic and stochastic dynamics not only provides insights into the possible dynamics of CREB regulatory motifs, but also demonstrates a framework for understanding other regulatory processes with similar network architecture.
Resumo:
Chemotherapy is a common and effective method to treat many forms of cancer. However, treatment of cancer with chemotherapy has severe side effects which often limit the doses of therapy administered. Because some cancer chemotherapeutics target proliferating cells and tissues, all dividing cells, whether normal or tumor, are affected. Cell culture studies have demonstrated that UCN-01 is able to reversibly and selectively arrest normal dividing cells; tumor cells lines do not undergo this temporary arrest. Following UCN-01 treatment, normal cells displayed a 50-fold increase in IC50 for camptothecin; tumor cells showed no such increased tolerance. We have examined the response of the proliferating tissues of the mouse to UCN- 01 treatment, using the small bowel epithelium as a model system. Our results indicate that UCN-01 treatment can cause a cell cycle arrest in the gut epithelium, beginning 24 hours following UCN-01 administration, with cell proliferation remaining suppressed for one week. Two weeks post-UCN-01 treatment the rate of proliferation returns to normal levels. 5-FU administered during this period demonstrates that UCN-01 is able to provide protection to normal cells of the mouse within a narrow window of efficacy, from three to five days post-UCN-01. UCN-01 pretreated mice displayed improved survival, weight status and blood markers following 5-FU compared to control mice, indicating that UCN-01 can protect normal dividing tissues. The mechanism by which UCN-01 arrests normal cells in vivo was also examined. We have demonstrated that UCN-01 treatment in mice causes an increase in the G1 phase cell cycle proteins cdk4 and cyclin D, as well as the inhibitor p27. Phosphorylated Rb was also elevated in the arrested cells. These results are a departure from cell culture studies, in which inhibition of G1 phase cyclin dependent kinases led to hyposphosphorylation of Rb. Future investigation will be required to understand the mechanism of UCN-01 action. This is important information, especially for identification of alternate compounds which could provide the protection afforded by UCN-01.
Resumo:
cAMP-response element binding (CREB) proteins are involved in transcriptional regulation in a number of cellular processes (e.g., neural plasticity and circadian rhythms). The CREB family contains activators and repressors that may interact through positive and negative feedback loops. These loops can be generated by auto- and cross-regulation of expression of CREB proteins, via CRE elements in or near their genes. Experiments suggest that such feedback loops may operate in several systems (e.g., Aplysia and rat). To understand the functional implications of such feedback loops, which are interlocked via cross-regulation of transcription, a minimal model with a positive and negative loop was developed and investigated using bifurcation analysis. Bifurcation analysis revealed diverse nonlinear dynamics (e.g., bistability and oscillations). The stability of steady states or oscillations could be changed by time delays in the synthesis of the activator (CREB1) or the repressor (CREB2). Investigation of stochastic fluctuations due to small numbers of molecules of CREB1 and CREB2 revealed a bimodal distribution of CREB molecules in the bistability region. The robustness of the stable HIGH and LOW states of CREB expression to stochastic noise differs, and a critical number of molecules was required to sustain the HIGH state for days or longer. Increasing positive feedback or decreasing negative feedback also increased the lifetime of the HIGH state, and persistence of this state may correlate with long-term memory formation. A critical number of molecules was also required to sustain robust oscillations of CREB expression. If a steady state was near a deterministic Hopf bifurcation point, stochastic resonance could induce oscillations. This comparative analysis of deterministic and stochastic dynamics not only provides insights into the possible dynamics of CREB regulatory motifs, but also demonstrates a framework for understanding other regulatory processes with similar network architecture.
Resumo:
STUDY OF REST AS A NEGATIVE REGULATOR OF P16INK4A Monica Gireud, B.S. Thesis Advisor: Vidya Gopalakrishnan, Ph.D. The RE1 Silencing Transcription Factor (REST) is a negative regulator of neuronal differentiation. It is expressed ubiquitously in early embryos, but downregulated in neural progenitors concomitant with onset of neuronal differentiation in these cells. REST has been widely studied as a negative regulator of neuronal differentiation genes. Our recent work identified a novel role for REST in control of cell proliferation. However, the underlying molecular mechanism(s) are not known and is a focus of the current thesis project. Here, we provide evidence that REST signaling controls the expression of the cyclin-dependent kinase inhibitor, p16Ink4a, a negative regulator of the cell cycle and passage through G1. We determined that REST expression in the proliferating granule progenitors of the cerebellum and its lack of expression in the differentiated neurons is reciprocally correlated with that of p16Ink4a. Decline in REST levels in differentiating primary and neural stem cells immortalized with v-myc (NSC-M) granule progenitors in vitro was also associated with upregulation of p16Ink4a expression. Conversely, constitutive human REST transgene expression in NSC-M cells (NSC-MRs) blocked p16Ink4 upregulation, even under neuronal differentiation conditions. However, the lack of a consensus REST DNA binding RE1 element in the regulatory regions of p16Ink4a locus suggested an indirect regulation of p16Ink4a by REST. Based on work from other groups that showed repression of p16Ink4a transcription by the polycomb protein Bmi-1, and its negative regulation by microRNA-203 (miR-203) and our identification of a RE1 element in the downstream regulatory region of miR-203, we asked if the p16Ink4a expression was controlled by REST through a series of negative regulatory events involving miR-203 and Bmi-1. We observed that Bmi1 -expression mirrored that of REST and inversely correlated with that of miR-203 in the postnatal cerebellum and in vitro differentiated granule and NSC-M progenitors. In contrast, forced REST transgene expression in NSC-MR cells abrogated the decrease in Bmi-1 levels and elevation in miR-203 expression. Significant REST binding to the miR-203 RE1 element was also observed in NSC-M cells, indicating that REST had the potential to directly regulate miR-203 expression. In conclusion, our studies suggest a role for REST in control of cell cycle transit in neural progenitors through negative regulation of p16Ink4a. Further validation of these results in REST knockout mice is needed, and is ongoing.
Resumo:
Despite many researches on development in education and psychology, not often is the methodology tested with real data. A major barrier to test the growth model is that the design of study includes repeated observations and the nature of the growth is nonlinear. The repeat measurements on a nonlinear model require sophisticated statistical methods. In this study, we present mixed effects model in a negative exponential curve to describe the development of children's reading skills. This model can describe the nature of the growth on children's reading skills and account for intra-individual and inter-individual variation. We also apply simple techniques including cross-validation, regression, and graphical methods to determine the most appropriate curve for data, to find efficient initial values of parameters, and to select potential covariates. We illustrate with an example that motivated this research: a longitudinal study of academic skills from grade 1 to grade 12 in Connecticut public schools. ^
Resumo:
The Drosophila Transformer-2 (Tra2) protein activates the splicing of doublesex and fruitless pre-mRNA and represses M1 intron splicing in its own RNA in male germline. The M1 retention is part of negative feedback mechanism that controls Tra2 protein synthesis. However it is not known how the M1 intron is repressed or why Tra2 activates splicing of some RNAs while repressing splicing in others. Here we show that Tra2 and SR protein Rbp1 function together to specifically repress M1 splicing in vitro through the same intronic silencer by binding independently to distinct sites. The role of Rbp1 in M1 repression in vivo was validated by the finding that increased expression of Rbp1 in S2 cells promotes M1 retention. Furthermore, Tra2 blocks prespliceosomal A complex formation, a step corresponding to U2 snRNP recruitment to the branchpoint. High levels of Tra2 repression require an upstream enhancer. Together, we propose that the complex formed by Tra2 and Rbp1 on the silencer achieves splicing repression by blocking the recognition of the branchpoint or antagonizing enhancer function. ^ In addition, both splicing regulatory activities of Tra2 are essential developmental events, doublesex splicing is the key for Drosophila sex determination in the soma, while M1 retention occurs in the male germline and is necessary for spermatogenesis. However, active Tra2 is expressed ubiquitously. So another issue we have studied is how Tra2 accomplishes negative and positive splicing regulation in a tissue-specific fashion. Surprisingly, we found that nuclear extract from somatically-derived S2 cells support M1 repression in vitro. This led us to hypothesize that no germline specific factor is required and that high levels of Tra2 expression in the male germline is sufficient to trigger M1 retention. To test it, I examined whether increased expression of Tra2 could promote M1 retention in cells outside male germline. My results show that increased Tra2 expression promotes M1 retention in somatically-derived S2 cells as well as in the somatic tissues of living flies. These results show that somatic tissues are capable of supporting M1 repression but do not normally do so because the low levels of Tra2 do not trigger negative feedback regulation. ^
Resumo:
Objective. To evaluate a school-based intervention aimed at the primary prevention of negative eating attitudes and behaviors among preadolescent girls, and to revise curriculum lessons based on quantitative and qualitative findings. ^ Intervention Design. A formative evaluation was conducted on four Team: Bee Me curriculum lessons at a Houston elementary school. Evaluation focused on program satisfaction and short-term effect on knowledge and eating attitudes and behaviors. ^ Results. Sixteen girls participated in the five-day project. Statistically significant improvements in overall knowledge were observed (p<0.05), however only modest changes were observed in eating attitudes and behaviors. Program satisfaction was high among student participants and the teacher who implemented it. Insight for future modifications to this program and for similar interventions was provided by the students and teacher. ^ Conclusions. This program led to positive trends in outcome variables; however longer and more intensive testing of this program is needed to better evaluate its effectiveness.^
Resumo:
Introduction. Selectively manned units have a long, international history, both military and civilian. Some examples include SWAT teams, firefighters, the FBI, the DEA, the CIA, and military Special Operations. These special duty operators are individuals who perform a highly skilled and dangerous job in a unique environment. A significant amount of money is spent by the Department of Defense (DoD) and other federal agencies to recruit, select, train, equip and support these operators. When a critical incident or significant life event occurs, that jeopardizes an operator's performance; there can be heavy losses in terms of training, time, money, and potentially, lives. In order to limit the number of critical incidents, selection processes have been developed over time to “select out” those individuals most likely to perform below desired performance standards under pressure or stress and to "select in" those with the "right stuff". This study is part of a larger program evaluation to assess markers that identify whether a person will fail under the stresses in a selectively manned unit. The primary question of the study is whether there are indicators in the selection process that signify potential negative performance at a later date. ^ Methods. The population being studied included applicants to a selectively manned DoD organization between 1993 and 2001 as part of a unit assessment and selection process (A&S). Approximately 1900 A&S records were included in the analysis. Over this nine year period, seventy-two individuals were determined to have had a critical incident. A critical incident can come in the form of problems with the law, personal, behavioral or family problems, integrity issues, and skills deficit. Of the seventy-two individuals, fifty-four of these had full assessment data and subsequent supervisor performance ratings which assessed how an individual performed while on the job. This group was compared across a variety of variables including demographics and psychometric testing with a group of 178 individuals who did not have a critical incident and had been determined to be good performers with positive ratings by their supervisors.^ Results. In approximately 2004, an online pre-screen survey was developed in the hopes of preselecting out those individuals with items that would potentially make them ineligible for selection to this organization. This survey has aided the organization to increase its selection rates and save resources in the process. (Patterson, Howard Smith, & Fisher, Unit Assessment and Selection Project, 2008) When the same prescreen was used on the critical incident individuals, it was found that over 60% of the individuals would have been flagged as unacceptable. This would have saved the organization valuable resources and heartache.^ There were some subtle demographic differences between the two groups (i.e. those with critical incidents were almost twice as likely to be divorced compared with the positive performers). Upon comparison of Psychometric testing several items were noted to be different. The two groups were similar when their IQ levels were compared using the Multidimensional Aptitude Battery (MAB). When looking at the Minnesota Multiphasic Personality Inventory (MMPI), there appeared to be a difference on the MMPI Social Introversion; the Critical Incidence group scored somewhat higher. When analysis was done, the number of MMPI Critical Items between the two groups was similar as well. When scores on the NEO Personality Inventory (NEO) were compared, the critical incident individuals tended to score higher on Openness and on its subscales (Ideas, Actions, and Feelings). There was a positive correlation between Total Neuroticism T Score and number of MMPI critical items.^ Conclusions. This study shows that the current pre-screening process is working and would have saved the organization significant resources. ^ If one was to develop a profile of a candidate who potentially could suffer a critical incident and subsequently jeopardize the unit, mission and the safety of the public they would look like the following: either divorced or never married, score high on the MMPI in Social Introversion, score low on MMPI with an "excessive" amount of MMPI critical items; and finally scores high on the NEO Openness and subscales Ideas, Feelings, and Actions.^ Based on the results gleaned from the analysis in this study there seems to be several factors, within psychometric testing, that when taken together, will aid the evaluators in selecting only the highest quality operators in order to save resources and to help protect the public from unfortunate critical incidents which may adversely affect our health and safety.^
Resumo:
Objectives. Triple Negative Breast Cancer (TNBC) lack expression of estrogen receptors (ER), progesterone receptors (PR), and absence of Her2 gene amplification. Current literature has identified TNBC and over-expression of cyclo-oxygenase-2 (COX-2) protein in primary breast cancer to be independent markers of poor prognosis in terms of overall and distant disease free survival. The purpose of this study was to compare COX-2 over-expression in TNBC patients to those patients who expressed one or more of the three tumor markers (i.e. ER, and/or PR, and/or Her2).^ Methods. Using a secondary data analysis, a cross-sectional design was implemented to examine the association of interest. Data collected from two ongoing protocols titled "LAB04-0657: a model for COX-2 mediated bone metastasis (Specific aim 3)" and "LAB04-0698: correlation of circulating tumor cells and COX-2 expression in primary breast cancer metastasis" was used for analysis. A sample of 125 female patients was analyzed using Chi-square tests and logistic regression models. ^ Results. COX-2 over-expression was present in 33% (41/125) and 28% (35/124) patients were identified as having TNBC. TNBC status was associated with elevated COX-2 expression (OR= 3.34; 95% CI= 1.40–8.22) and high tumor grade (OR= 4.09; 95% CI= 1.58–10.82). In a multivariable analysis, TNBC status was an important predictor of COX-2 expression after adjusting for age, menopausal status, BMI, and lymph node status (OR= 3.31; 95% CI: 1.26–8.67; p=0.01).^ Conclusion. TNBC is associated with COX-2 expression—a known marker of poor prognosis in patients with operable breast cancer. Replication of these results in a study with a larger sample size, or a future randomized clinical trial demonstrating an improved prognosis with COX-2 suppression in these patients would support this hypothesis.^
Resumo:
Although coagulase-negative staphylococci (C-NS) have been implicated in certain human infections, they are generally regarded as contaminants and their clinical significance is questioned. To assess their role as pathogens, 205 isolates of C-NS from wounds, and body fluids (blood, urine, pleural and peritoneal fluids, etc.) were studied. Patient's charts were reviewed and using strict criteria a determination was made regarding the clinical significance of these isolates. The organisms were then identified using the scheme of Kloos and Schleifer to determine if certain species of C-NS were associated with specific infections. S. epidermidis sensu stricto accounted for 81% of the C-NS isolated; the frequency of other species was S. haemolyticus (6%), S. hominis (5%), S. capitis (4%), S. warneri (3%), and others (1%). Only two isolates were novobiocin resistant; neither was identified as S. saprophyticus. Using these criteria, 22% of C-NS were considered to be clinically significant and the majority of these (93%) were due to S. epidermidis. The most common source of the clinically relevant C-NS isolates was from wounds. These data suggest that identifying C-NS species other than S. epidermidis may be of limited value in predicting clinical significance.^ In addition, selected pathogenic and non-pathogenic strains of C-NS were compared for their ability to adhere to human cells in vitro. Although the results were not conclusive, it appeared that pathogenic C-NS adhered more avidly than non-pathogenic C-NS to buccal cells. Experiments with HeLa cells showed no difference between pathogenic and non-pathogenic C-NS in adherence abilities. ^
Resumo:
Breast cancer is the most common cancer diagnosis and second leading cause of death in women. Risk factors associated with breast cancer include: increased age, alcohol consumption, cigarette smoking, white race, physical inactivity, benign breast conditions, reproductive and hormonal factors, dietary factors, and family history. Hereditary breast and ovarian cancer syndrome (HBOC) is caused by mutations in the BRCA1 and BRCA2 genes. Women carrying a mutation in these genes are at an increased risk to develop a second breast cancer. Contralateral breast cancer is the most common second primary cancer in patients treated for a first breast cancer. Other risk factors for developing contralateral breast cancer include a strong family history of breast cancer, age of onset of first primary breast cancer, and if the first primary was a lobular carcinoma, which has an increased risk of being bilateral. A retrospective chart review was performed on a select cohort of women in an IRB approved database at MD Anderson Cancer Center. The final cohort contained 572 women who tested negative for a BRCA1 or BRCA2 mutation, had their primary invasive breast cancer diagnosed under the age of 50, and had a BRCAPro risk assessment number over 10%. Of the 572 women, 97 women developed contralateral breast cancer. A number of predictors of contralateral breast cancer were looked at between the two groups. Using univariable Cox Proportional Hazard model, thirteen statistically interesting risk factors were found, defined as having a p-value under 0.2. Multivariable stepwise Cox Proportional Hazard model found four statistically significant variables out of the thirteen found in the univariable analysis. In our study population, the incidence of contralateral breast cancer was 17%. Four statistically significant variables were identified. Undergoing a prophylactic mastectomy was found to reduce the risk of developing contralateral breast cancer, while not having a prophylactic mastecomy, a young age at primary diagnosis, having a positive estrogen receptor status of the primary tumor, and having a family history of breast cancer increased a woman’s risk to develop contralateral breast cancer.
Resumo:
Background. Breast cancer is the most frequently diagnosed cancer and the leading cause of cancer death among females, accounting for 23% (1.38 million) of the total new cancer cases and 14% (458,400) of the total cancer deaths in 2008. [1] Triple-negative breast cancer (TNBC) is an aggressive phenotype comprising 10–20% of all breast cancers (BCs). [2-4] TNBCs show absence of estrogen, progesterone and HER2/neu receptors on the tumor cells. Because of the absence of these receptors, TNBCs are not candidates for targeted therapies. Circulating tumor cells (CTCs) are observed in blood of breast cancer patients even at early stages (Stage I & II) of the disease. Immunological and molecular analysis can be used to detect the presence of tumor cells in the blood (Circulating tumor cells; CTCs) of many breast cancer patients. These cells may explain relapses in early stage breast cancer patients even after adequate local control. CTC detection may be useful in identifying patients at risk for disease progression, and therapies targeting CTCs may improve outcome in patients harboring them. Methods . In this study we evaluated 80 patients with TNBC who are enrolled in a larger prospective study conducted at M D Anderson Cancer Center in order to determine whether the presence of circulating tumor cells is a significant prognostic factor in relapse free and overall survival . Patients with metastatic disease at the time of presentation were excluded from the study. CTCs were assessed using CellSearch System™ (Veridex, Raritan, NJ). CTCs were defined as nucleated cells lacking the presence of CD45 but expressing cytokeratins 8, 18 or 19. The distribution of patient and tumor characteristics was analyzed using chi square test and Fisher's exact test. Log rank test and Cox regression analysis was applied to establish the association of circulating tumor cells with relapse free and overall survival. Results. The median age of the study participants was 53years. The median duration of follow-up was 40 months. Eighty-eight percent (88%) of patients were newly diagnosed (without a previous history of breast cancer), and (60%) of patients were chemo naïve (had not received chemotherapy at the time of their blood draw for CTC analysis). Tumor characteristics such as stage (P=0.40), tumor size (P=69), sentinel nodal involvement (P=0.87), axillary lymph node involvement (P=0.13), adjuvant therapy (P=0.83), and high histological grade of tumor (P=0.26) did not predict the presence of CTCs. However, CTCs predicted worse relapse free survival (1 or more CTCs log rank P value = 0.04, at 2 or more CTCs P = 0.02 and at 3 or more CTCs P < 0.0001) and overall survival (at 1 or more CTCs log rank P value = 0.08, at 2 or more CTCs P = 0.01 and at 3 or more CTCs P = 0.0001. Conclusions. The number of circulating tumor cells predicted worse relapse free survival and overall survival in TNBC patients.^
Resumo:
Triple-negative breast cancers (TNBC) are characterized by the lack of or reduced expression of the estrogen and progesterone receptors, and normal expression of the human epidermal growth factor receptor 2. The lack of a well-characterized target for treatment leaves only systemic chemotherapy as the mainstay of treatment. Approximately 60-70% of patients are chemosensitive, while the remaining majority does not respond. Targeted therapies that take advantage of the unique molecular perturbations found in triple-negative breast cancer are needed. The genes that are frequently amplified or overexpressed represent potential therapeutic targets for triple-negative breast cancer. The purpose of this study was to identify and validate novel therapeutic targets for triple-negative breast cancers. 681 genes showed consistent and highly significant overexpression in TNBC compared to receptor-positive cancers in 2 data sets. For two genes, 3 of the 4 siRNAs showed preferential growth inhibition in TNBC cells. These two genes were the low density lipoprotein receptor-related protein 8 (LRP8) and very low-density lipoprotein receptor (VLDLR). Exposure to their cognate ligands, reelin and apolipoprotein E isoform 4 (ApoE4), stimulated the growth of TNBC cells in vitro. Suppression of the expression of either LRP8 or VLDLR or exposure to RAP (an inhibitor of ligand binding to LRP8 and VLDLR) abolished this ligand-induced proliferation. High-throughput protein and metabolic arrays revealed that ApoE4 stimulation rescued TNBC cells from serum-starvation induced up-regulation of genes involved in lipid biosynthesis, increased protein expression of oncogenes involved in the MAPK/ERK and DNA repair pathways, and reduced the serum-starvation induction of biochemicals involved in oxidative stress response and glycolytic metabolism. shLRP8 MDA-MB-231 xenografts had reduced tumor volume, in comparison to parental and shCON xenografts. These results indicate that LRP8-APOE signaling confers survival advantages to TNBC tumors under reduced nutrient conditions and during cellular environmental stress. We revealed that the LRP8-APOE receptor-ligand system is overexpressed in human TNBC. We also demonstrated that this receptor system mediates a strong growth promoting and survival function in TNBC cells in vitro and helps to sustain the growth of MDA-MD-231 xenografts. We propose that inhibitors of LRP8-APOE signaling may be clinically useful therapeutic agents for triple-negative breast cancer.
Resumo:
The first part of my research involved the characterization of the neu gene promoter. I subcloned a 2.2-kb sequence located upstream to the extreme 5$\sp\prime$ end of the neu gene, in front of the bacterial reporter gene, chloramphenicol acetyltransferase (CAT). Transfection of this construct into different cell lines and subsequent CAT assays demonstrated that this 2.2-kb fragment was functional as a promoter. A series of deletion constructs was engineered to study the contribution of different fragments to transcription. Subcloning of individual fragments was followed by a cotransfection competition experiment, which demonstrated the involvement of protein factors interacting with the promoter. A gel retardation assay was also performed to show the physical binding of protein factors to the promoter. The combined results suggested that both positively and negatively acting protein factors are involved in interacting with different regions of the promoter, contributing to the overall transcription activity. My findings provide an insight into the regulation of neu gene expression, which in turn provides the tools to understand the molecular mechanisms of overexpression of the neu gene in some breast cancer and ovarian cancer cell lines.^ In the second part of my research, I discovered that another oncogene, c-myc, was able to reverse the transformed morphology that was induced by the neu oncogene. Utilizing the promoter constructs that I made, I was able to show that the c-myc oncogene has a negative regulatory effect on the expression of the neu oncogene. Further studies suggested that c-myc is able to lower the effective concentration of a positive factor(s) that interact with a 139-bp fragment of the neu gene promoter. These findings may provide a direct evidence of the long suspected role of the c-myc gene in transcriptional regulation. The neu gene may very well be the first identified mammalian target gene that is regulated by the c-myc oncogene. Since c-myc is known to be stimulated by various mitogenic signals and the neu gene is likely to be a growth factor receptor, it is possible that c-myc, when stimulated by the signal transduction pathway of the neu gene, would function as a negative feedback regulator on the neu gene receptor. (Abstract shortened with permission of author.) ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^