22 resultados para Molecular Characterization
em DigitalCommons@The Texas Medical Center
Resumo:
A strain of Saccaromyces cerevisiae (SC3B) with a temperature sensitive defect in the synthesis of DNA has been isolated. This defect is due to a single recessive mutation in a gene named INS1 required for the initiation of S phase. Arrested cells carrying the ins1$\sp{ts}$ allele are defective in the completion of G1 to S phase transition events including SPB duplication or separation, initiation of DNA synthesis, normal control of budding, and bud neck stability. The mutation and a gene which complements the mutation were mapped to chromosome IV. The complementing gene was proved to be the wild type allele of the temperature sensitive mutation by genetic linkage of an integrated clone. A very low abundance 4.2 kb RNA message was observed in the strain SC3B which increased greatly in this strain transformed with a multiple copy plasmid carrying the complementing clone. The wild type gene was sequenced and found to encode a 1268 amino acid protein of with a molecular weight of 142,655 Daltons. Computer assisted searches for similar DNA sequences revealed no significant homology matches. However, searches for protein sequence homology revealed a protein (the DIS3 gene product of S. pombe) with a similar sequence over a 534 amino acid stretch to the predicted INS1 gene product. A later search revealed a near identical sequence for a gene (SRK1) also isolated from S. cerevisiae. ^
Resumo:
Ecteinascidin 743 (Et-743), which is a novel DNA minor groove alkylator with a unique spectrum of antitumor activity, is currently being evaluated in phase II/III clinical trials. Although the precise molecular mechanisms responsible for the observed antitumor activity are poorly understood, recent data suggests that post-translational modifications of RNA polymerase II Large Subunit (RNAPII LS) may play a central role in the cellular response to this promising anticancer agent. The stalling of an actively transcribing RNAPII LS at Et-743-DNA adducts is the initial cellular signal for transcription-coupled nucleotide excision repair (TC-NER). In this manner, Et-743 poisons TC-NER and produces DNA single strand breaks. Et-743 also inhibits the transcription and RNAPII LS-mediated expression of selected genes. Because the poisoning of TC-NER and transcription inhibition are critical components of the molecular response to Et-743 treatment, we have investigated if changes in RNAPII LS contribute to the disruption of these two cellular pathways. In addition, we have studied changes in RNAPII LS in two tumors for which clinical responses were reported in phase I/II clinical trials: renal cell carcinoma and Ewing's sarcoma. Our results demonstrate that Et-743 induces degradation of the RNAPII LS that is dependent on active transcription, a functional 26S proteasome, and requires functional TC-NER, but not global genome repair. Additionally, we have provided the first experimental data indicating that degradation of RNAPII LS might lead to the inhibition of activated gene transcription. A set of studies performed in isogenic renal carcinoma cells deficient in von Hippel-Lindau protein, which is a ubiquitin-E3-ligase for RNAPII LS, confirmed the central role of RNAPII LS degradation in the sensitivity to Et-743. Finally, we have shown that RNAPII LS is also degraded in Ewing's sarcoma tumors following Et-743 treatment and provide data to suggest that this event plays a role in decreased expression of the Ewing's sarcoma oncoprotein, EWS-Fli1. Altogether, these data implicate degradation of RNAPII LS as a critical event following Et-743 exposure and suggest that the clinical activity observed in renal carcinoma and Ewing's sarcoma may be mediated by disruption of molecular pathways requiring a fully functional RNAPII LS. ^
Resumo:
Antibodies which bind bioactive ligands can serve as a template for the generation of a second antibody which may react with the physiological receptor. This phenomenon of molecular mimicry by antibodies has been described in a variety of systems. In order to understand the chemical and molecular mechanisms involved in these interactions, monoclonal antibodies directed against two pharmacologically active alkaloids, morphine and nicotine, were carefully studied using experimental and theoretical molecular modeling techniques. The molecular characterization of these antibodies involved binding studies with ligand analogs and determination of the variable region amino acid sequence. A three-dimensional model of the anti-morphine binding site was constructed using computational and graphics display techniques. The antibody response in BALB/c mice to morphine appears relatively restricted, in that all of the antibodies examined in this study contained a $\lambda$ light chain, which is normally found in only 5% of mouse immunoglobulins. This study represents the first use of theoretical and experimental modeling techniques to describe the antigen binding site of a mouse Fv region containing a $\lambda$ light chain. The binding site model indicates that a charged glutamic acid residue and aromatic side chains are key features in ionic and hydrophobic interactions with the ligand morphine. A glutamic acid residue is found in the identical position in the anti-nicotine antibody and may play a role in binding nicotine. ^
Resumo:
Transglutaminases are a family of calcium-dependent enzymes, that catalyze the covalent cross-linking of proteins by forming $\varepsilon(\gamma$-glutamyl)lysine isopeptide bonds. In order to investigate the molecular mechanisms regulating the expression of the tissue transglutaminase gene and to determine its biological functions, the goal of this research has been to clone and characterize the human tissue transglutaminase promoter. Thirteen clones of the tissue transglutaminase gene were obtained from the screening of a human placental genomic DNA library. A 1.74 Kb fragment derived from DNA located immediately upstream of the translation start site was subcloned and sequenced. Sequence analysis of this DNA fragment revealed that it contains a TATA box (TATAA), a CAAT box (GGACAAT), and a series of potential transcription factor binding sites and hormone response elements. Four regions of significant homology, a GC-rich region, a TG-rich region, an AG-rich region, and HR1, were identified by aligning 1.8 Kb of DNA flanking the human, mouse, and guinea pig tissue transglutaminase genes.^ To measure promoter activity, we subcloned the 1.74 Kb fragment of the tissue transglutaminase gene into a luciferase reporter vector to generate transglutaminase promoter/luciferase reporter constructs. Transfection experiments showed that this DNA segment includes a functional promoter with high constitutive activity. Deletion analysis revealed that the SP1 sites or corresponding sequences contribute to this activity. We investigated the role of DNA methylation in regulating the activity of the promoter and found that in vitro methylation of tissue transglutaminase promoter/luciferase reporter constructs suppressed their basal activity. Methylation of the promoter is inversely correlated with the expression of the tissue transglutaminase gene in vivo. These results suggest that DNA methylation may be one of the mechanisms regulating the expression of the gene. The tumor suppressor gene product p53 was also shown to inhibit the activity of the promoter, suggesting that induction of the tissue transglutaminase gene is not involved in the p53-dependent programmed cell death pathway. Although retinoids regulate the expression of the tissue transglutaminase gene in vivo, retinoid-inducible activity can not be identified in 3.7 Kb of DNA 5$\sp\prime$ to the tissue transglutaminase gene.^ The structure of the 5$\sp\prime$ end of the tissue transglutaminase gene was mapped. Alignment analysis of the human tissue transglutaminase gene with other human transglutaminases showed that tissue transglutaminase is the simplest member of transglutaminase superfamily. Transglutaminase genes show a conserved core of exons and introns but diverse N-terminuses and promoters. These observations suggest that key regulatory sequences and promoter elements have been appended upstream of the core transglutaminase gene to generate the diversity of regulated expression and regulated activity characteristic of the transglutaminase gene family. ^
Resumo:
CYP4F enzymes metabolize endogenous molecules including arachidonic acid, leukotrienes and prostaglandins. The involvement of these eisosanoids in inflammation has led to the hypothesis that CYP4Fs may modulate inflammatory conditions after traumatic brain injury (TBI). In rat, TBI elicited changes in mRNA expression of CYP4Fs as a function of time in the cerebrum region. These changes in CYP4F mRNA levels inversely correlated with the cerebral leukotriene B4 (LTB4) level following injury at the same time points. TBI also resulted in changes in CYP4F protein expression and localization around the injury site, where CYP4F1 and CYP4F6 immunoreactivity increased in surrounding astrocytes and CYP4F4 immunoreactivity shifted from endothelia of cerebral vessels to astrocytes. The study with rat primary astrocytes indicated that pro-inflammatory cytokines TNFα and IL-1β could affect the transcription of CYP4Fs to a certain degree, whereas the changing pattern in the primary astrocytes appeared to be different from that in the in vivo TBI model.^ In addition, the regulation of CYP4F genes has been an unsolved issue although factors including cytokines and fatty acids appear to affect CYP4Fs expression in multiple models. In this project, HaCaT cells were used as an in vitro cellular model to define signaling pathways involved in the regulation of human CYP4F genes. Retinoic acids inhibited CYP4F11 expression, whereas cytokines TNFα and IL-1β induced transcription of CYP4F11 in HaCaT cells. The induction of CYP4F11 by both cytokines could be blocked by a JNK specific inhibitor, indicating the involvement of the JNK pathway in the up-regulation of CYP4F11. Retinoic acids are known to function in gene regulation through nuclear receptors RARs and RXRs. The RXR agonist LG268 greatly induced transcription of CYP4F11, whereas RAR agonist TTNPB obviously inhibited CYP4F11 transcription, indicating that the down-regulation of CYP4F11 by retinoic acid was mediated by RARs, and that inhibition of CYP4F11 by retinoic acid may also be related to the competition for RXR receptors. Thus, the CYP4F11 gene is regulated by signaling pathways including the RXR pathway and the JNK pathway. In contrast, the regulation mechanism of other CYP4Fs by retinoic acids appears to be different from that of CYP4F11.^
Resumo:
The slow/cardiac alkali myosin light chain (MLC1s/1c) is a member of a multigene family whose protein products are essential for activation of the myosin ATPase. In the adult, the MLC1s/1c isoform is expressed in both cardiac and slow-twitch skeletal muscles, while it is expressed by all skeletal muscles during development.^ To elucidate the molecular mechanisms that underlie the transcriptional regulation of MLC1s/1c gene expression, the immediate 5$\sp\prime$ flanking region of the gene was isolated and shown to be capable of directing reporter gene expression. Analysis of this region revealed a 110 bp muscle-specific enhancer that includes a myocyte-specific enhancer-binding factor 2 (MEF-2) site, E-boxes, which are potential binding sites for the basic-helix-loop-helix proteins such as MyoD, and a MLC box. The focus of the thesis was to identify the role of the MLC box in expression of the MLC1s/1c gene.^ The MLC box is a member of the family of CArG box containing cis-acting DNA elements. Mutagenesis showed that the MLC box is necessary, but not sufficient, for the expression of a reporter gene linked to the 5$\sp\prime$ flanking region of the MLC1s/1c gene. Linker scanner and site-directed mutagenesis identified a number of potential sites within the 110 bp muscle-specific enhancer that may cooperate with the MLC box. These are the MEF-2 site, the E-box site, and a 10 bp element located upstream of the MEF-2 site that does not have sequence similarity with any known cis-acting element. The MLC box is capable of binding to factors present in muscle nuclear extracts, as well as to human recombinant serum response factor (SRF). Binding of SRF to the MLC box was correlated with the ability of the 5$\sp\prime$ flanking region of the MLC1s/1c gene to drive reporter gene expression. Results suggest a model in which binding of SRF to the MLC box activates expression of the MLC1s/1c gene while binding of the factors present in the nuclear extracts suppresses the expression of the gene. (Abstract shortened with permission of author.) ^
Resumo:
The non-Hodgkin's B cell lymphomas are a diverse group of neoplastic diseases. The incidence rate of the malignant tumors has been rising rapidly over the past twenty years in the United States and worldwide. The lack of insight to pathogenesis of the disease poses a significant problem in the early detection and effective treatment of the human malignancies. These studies attempted to investigate the molecular basis of pathogenesis of the human high grade B cell non-Hodgkin's lymphomas with a reverse genetic approach. The specific objective was to clone gene(s) which may play roles in development and progression of human high grade B cell non-Hodgkin's lymphomas.^ The messenger RNAs from two high grade B cell lymphoma lines, CJ and RR, were used for construction of cDNA libraries. Differential screening of the derived cDNA libraries yielded a 1.4 kb cDNA clone. The gene, designated as NHL-B1.4, was shown to be highly amplified and over-expressed in the high grade B cell lymphoma lines. It was not expressed in the peripheral blood lymphoid cells from normal donors. However, it was inducible in peripheral blood T lymphocytes by a T cell mitogen, PHA, but could not be activated in normal B cells by B cell mitogen PMA. Further molecular characterization revealed that the gene may have been rearranged in the RR and some other B cell lymphoma lines. The coding capacity of the cDNA has been confirmed by a rabbit reticulocyte lysate and wheat germ protein synthesis system. A recombinant protein with a molecular weight of approximate 30 kDa was visualized in autoradiogram. Polyclonal antisera have been generated by immunization of two rabbits with the NHL-B1.4 recombinant protein produced in the E. coli JM109. The derived antibody can recognize a natural protein with molecular weight of 49 kDa in cell lysate of activated peripheral T lymphocytes of normal donors and both the cell lysate and supernatant of RR B cell lymphoma lines. The possible biologic functions of the molecule has been tested preliminarily in a B lymphocyte proliferation assay. It was found that the Q-sepharose chromatograph purified supernatant of COS cell transfection could increase tritiated thymidine uptake by B lymphocytes but not by T lymphocytes. The B cell stimulatory activity of the supernatant of COS cell tranfection could be neutralized by the polyclonal antisera, indicating that the NHL-B1.4 gene product may be a molecule with BCGF-like activity.^ The expression profiles of NHL-B1.4 in normal and neoplastic lymphoid cells were consistent with the current B lymphocyte activation model and autocrine hypothesis of high grade B cell lymphomagenesis. These results suggested that the NHL-B1.4 cDNA may be a disease-related gene of human high grade B cell lymphomas, which may codes for a postulated B cell autocrine growth factor. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^
Resumo:
Ribbon synapses of the vertebrate retina are specialized synapses that release neurotransmitter by synaptic vesicle exocytosis in a manner that is proportional to the level of depolarization of the cell. This release property is different from conventional neurons, in which the release of neurotransmitter occurs as a short-lived burst triggered by an action potential. Synaptic vesicle exocytosis is a calcium regulated process that is dependent on a set of interacting synaptic proteins that form the so-called SNARE (soluble N-ethylmaleimide sensitive factor attachment protein receptor) complex. Syntaxin 3B has been identified as a specialized SNARE molecule in ribbon synapses of the rodent retina. However, the best physiologically-characterized neuron that forms ribbon-style synapses is the rod-dominant or Mb1 bipolar cell of the goldfish retina. We report here the molecular characterization of syntaxin 3B from the goldfish retina. Using a combination of reverse transcription (RT) polymerase chain reaction (PCR) and immunostaining with a specific antibody, we show that syntaxin 3B is highly enriched in the plasma membrane of bipolar cell synaptic terminals of the goldfish retina. Using membrane capacitance measurements we demonstrate that a peptide derived from goldfish syntaxin 3B inhibits synaptic vesicle exocytosis. These experiments demonstrate that syntaxin 3B is an important factor for synaptic vesicle exocytosis in ribbon synapses of the vertebrate retina.
Resumo:
CONTRIBUTION OF ECTODOMAIN MUTATIONS IN EPIDERMAL GROWTH FACTOR RECEPTOR TO SIGNALING IN GLIOBLASTOMA MULTIFORME Publication No._________ Marta Rojas, M.S. Supervisory Professor: Oliver Bögler, Ph.D. The Cancer Genome Atlas (TCGA) has conducted a comprehensive analysis of a large tumor cohort and has cataloged genetic alterations involving primary sequence variations and copy number aberrations of genes involved in key signaling pathways in glioblastoma (GBM). This dataset revealed missense ectodomain point mutations in epidermal growth factor receptor (EGFR), but the biological and clinical significance of these mutations is not well defined in the context of gliomas. In our study, we focused on understanding and defining the molecular mechanisms underlying the functions of EGFR ectodomain mutants. Using proteomic approaches to broadly analyze cell signaling, including antibody array and mass spectrometry-based methods, we found a differential spectrum of tyrosine phosphorylation across the EGFR ectodomain mutations that enabled us to stratify them into three main groups that correlate with either wild type EGFR (EGFR) or the long-studied mutant, EGFRvIII. Interestingly, one mutant shared characteristics of both groups suggesting a continuum of behaviors along which different mutants fall. Surprisingly, no substantial differences were seen in activation of classical downstream signaling pathways such as Akt and S6 pathways between these classes of mutants. Importantly, we demonstrated that ectodomain mutations lead to differential tumor growth capabilities in both in vitro (anchorage independent colony formation) and in vivo conditions (xenografts). Our data from the biological characterization allowed us to categorize the mutants into three main groups: the first group typified by EGFRvIII are mutations with a more aggressive phenotype including R108K and A289T; a second group characterized by a less aggressive phenotype exemplified by EGFR and the T263P mutation; and a third group which shared characteristics from both groups and is exemplified by the mutation A289D. In addition, we treated cells overexpressing the mutants with various agents employed in the clinic including temozolomide, cisplatin and tarceva. We found that cells overexpressing the mutants in general displayed resistance to the treatments. Our findings yield insights that help with the molecular characterization of these mutants. In addition, our results from the drug studies might be valuable in explaining differential responses to specific treatments in GBM patients.
Resumo:
Background. The population-based Houston Tuberculosis Initiative (HTI) study has enrolled and gathered demographic, social, behavioral, and disease related data on more than 80% of all reported Mycobacterium Tuberculosis (MTB) cases and 90% of all culture positive patients in Houston/Harris County over a 9 year period (from October 1995-September 2004). During this time period 33% (n=1210) of HTI MTB cases have reported a history of drug use. Of those MTB cases reporting a history of drug use, a majority of them (73.6%), are non-injection drug users (NIDUs). ^ Other than HIV, drug use is the single most important risk factor for progression from latent to infectious tuberculosis (TB). In addition, drug use is associated with increased transmission of active TB, as seen by the increased number of clonally related strains or clusters (see definition on page 30) found in this population. The deregulatory effects of drug use on immune function are well documented. Associations between drug use and increased morbidity have been reported since the late 1970's. However, limited research focused on the immunological consequence of non-injection drug use and its relation to tuberculosis infection among TB patients is available. ^ Methods. TB transmission patterns, symptoms, and prevalence of co-morbidities were a focus of this project. Smoking is known to suppress Nitric Oxide (NO) production and interfere with immune function. In order to limit any possible confounding due to smoking two separate analyses were done. Non-injection drug user smokers (NIDU-S) were compared to non-drug user smokers (NDU-S) and non-injection drug user non-smokers (NIDU-NS) were compared to non-drug user non-smokers (NDU-NS) individually. Specifically proportions, chi-square p-values, and (where appropriate) odds ratios with 95% confidence intervals were calculated to assess characteristics and potential associations of co-morbidities and symptoms of TB among NIDUs HTI TB cases. ^ Results. Significant differences in demographic characteristics and risk factors were found. In addition drug users were found to have a decreased risk for cancer, diabetes mellitus, and chronic pulmonary disease. They were at increased risk of having HIV/AIDS diagnosis, liver disease, and trauma related morbidities. Drug users were more likely to have pulmonary TB disease, and a significantly increased amount of clonally related strains of TB or "clusters" were seen in both smokers and non-smoker drug users when compared to their non-drug user counterparts. Drug users are more likely to belong to print groups (clonally related TB strains with matching spoligotypes) including print one and print three and the Beijing family group, s1. Drug users were found to be no more likely to experience drug resistance to TB therapy and were likely to be cured of disease upon completion of therapy. ^ Conclusion. Drug users demographic and behavioral risk factors put them at an increased risk contracting and spreading TB disease throughout the community. Their increased levels of clustering are evidence of recent transmission and the significance of certain print groups among this population indicate the transmission is from within the social family. For these reasons a focus on this "at risk population" is critical to the success of future public health interventions. Successful completion of directly observed therapy (DOT), the tracking of TB outbreaks and incidence through molecular characterization, and increased diagnostic strategies have led to the stabilization of TB incidence in Houston, Harris County over the past 9 years and proven that the Houston Tuberculosis Initiative has played a critical role in the control and prevention of TB transmission. ^
Resumo:
The study was carried out at St. Luke's Episcopal Hospital to evaluate environmental contamination of Clostridium difficile in the infected patient rooms. Samples were collected from the high risk areas and were immediately cultured for the presence of Clostridium difficile . Lack of microbial typing prevented the study of molecular characterization of the Clostridium difficile isolates obtained led to a change in the study hypothesis. The study found a positivity of 10% among 50 Hospital rooms sampled for the presence of Clostridium difficile. The study provided data that led to recommendations that routine environmental sampling be carried in the hospital rooms in which patients with CDAD are housed and that effective environmental disinfection methods are used. The study also recommended molecular typing methods to allow characterization of the CD strains isolated from patients and environmental sampling to determine their type, similarity and origin.^
Resumo:
To reach the goals established by the Institute of Medicine (IOM) and the Centers for Disease Control's (CDC) STOP TB USA, measures must be taken to curtail a future peak in Tuberculosis (TB) incidence and speed the currently stagnant rate of TB elimination. Both efforts will require, at minimum, the consideration and understanding of the third dimension of TB transmission: the location-based spread of an airborne pathogen among persons known and unknown to each other. This consideration will require an elucidation of the areas within the U.S. that have endemic TB. The Houston Tuberculosis Initiative (HTI) was a population-based active surveillance of confirmed Houston/Harris County TB cases from 1995–2004. Strengths in this dataset include the molecular characterization of laboratory confirmed cases, the collection of geographic locations (including home addresses) frequented by cases, and the HTI time period that parallels a decline in TB incidence in the United States (U.S.). The HTI dataset was used in this secondary data analysis to implement a GIS analysis of TB cases, the locations frequented by cases, and their association with risk factors associated with TB transmission. ^ This study reports, for the first time, the incidence of TB among the homeless in Houston, Texas. The homeless are an at-risk population for TB disease, yet they are also a population whose TB incidence has been unknown and unreported due to their non-enumeration. The first section of this dissertation identifies local areas in Houston with endemic TB disease. Many Houston TB cases who reported living in these endemic areas also share the TB risk factor of current or recent homelessness. Merging the 2004–2005 Houston enumeration of the homeless with historical HTI surveillance data of TB cases in Houston enabled this first-time report of TB risk among the homeless in Houston. The homeless were more likely to be US-born, belong to a genotypic cluster, and belong to a cluster of a larger size. The calculated average incidence among homeless persons was 411/100,000, compared to 9.5/100,000 among housed. These alarming rates are not driven by a co-infection but by social determinants. The unsheltered persons were hospitalized more days and required more follow-up time by staff than those who reported a steady housing situation. The homeless are a specific example of the increased targeting of prevention dollars that could occur if TB rates were reported for specific areas with known health disparities rather than as a generalized rate normalized over a diverse population. ^ It has been estimated that 27% of Houstonians use public transportation. The city layout allows bus routes to run like veins connecting even the most diverse of populations within the metropolitan area. Secondary data analysis of frequent bus use (defined as riding a route weekly) among TB cases was assessed for its relationship with known TB risk factors. The spatial distribution of genotypic clusters associated with bus use was assessed, along with the reported routes and epidemiologic-links among cases belonging to the identified clusters. ^ TB cases who reported frequent bus use were more likely to have demographic and social risk factors associated with poverty, immune suppression and health disparities. An equal proportion of bus riders and non-bus riders were cultured for Mycobacterium tuberculosis, yet 75% of bus riders were genotypically clustered, indicating recent transmission, compared to 56% of non-bus riders (OR=2.4, 95%CI(2.0, 2.8), p<0.001). Bus riders had a mean cluster size of 50.14 vs. 28.9 (p<0.001). Second order spatial analysis of clustered fingerprint 2 (n=122), a Beijing family cluster, revealed geographic clustering among cases based on their report of bus use. Univariate and multivariate analysis of routes reported by cases belonging to these clusters found that 10 of the 14 clusters were associated with use. Individual Metro routes, including one route servicing the local hospitals, were found to be risk factors for belonging to a cluster shown to be endemic in Houston. The routes themselves geographically connect the census tracts previously identified as having endemic TB. 78% (15/23) of Houston Metro routes investigated had one or more print groups reporting frequent use for every HTI study year. We present data on three specific but clonally related print groups and show that bus-use is clustered in time by route and is the only known link between cases in one of the three prints: print 22. (Abstract shortened by UMI.)^